ID: 1033967111

View in Genome Browser
Species Human (GRCh38)
Location 7:146989373-146989395
Sequence CACTGGATACAGGTTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033967108_1033967111 -9 Left 1033967108 7:146989359-146989381 CCACTTTGGCCAGTCACTGGATA 0: 1
1: 0
2: 2
3: 15
4: 146
Right 1033967111 7:146989373-146989395 CACTGGATACAGGTTGCCCCAGG 0: 1
1: 0
2: 2
3: 26
4: 171
1033967104_1033967111 26 Left 1033967104 7:146989324-146989346 CCTGTGTTGGGGTGATGGGACTG 0: 1
1: 0
2: 4
3: 18
4: 307
Right 1033967111 7:146989373-146989395 CACTGGATACAGGTTGCCCCAGG 0: 1
1: 0
2: 2
3: 26
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033967111 Original CRISPR CACTGGATACAGGTTGCCCC AGG Intronic
902418686 1:16259930-16259952 CACTGGCCACATGTTGCCCGTGG + Intronic
903825913 1:26145739-26145761 CACCAGATACAGGCTGCCCTAGG + Intergenic
904864909 1:33570759-33570781 CACTGGATGCAGGCTGGCCTAGG - Intronic
905166503 1:36086246-36086268 CAGTGGATACCGGCTGCCCAGGG - Intronic
905183613 1:36180742-36180764 CACAGGATACTGGTTGCTTCAGG + Exonic
907940858 1:59085620-59085642 CACTGGATGTAGGTTGCTACAGG + Intergenic
910559464 1:88575222-88575244 CATTGGATGTAGGTTGCTCCTGG - Intergenic
911873572 1:103130281-103130303 TATTGGATTCAGGTTGCCCACGG + Intergenic
912320629 1:108709373-108709395 CACTGGATGTAGGTGGCCCAGGG + Intergenic
913182437 1:116335077-116335099 CATTGGATGCAGGCTGCCCCAGG - Intergenic
915912697 1:159924507-159924529 CACCGGCTTCAGGTAGCCCCAGG + Intronic
919904284 1:202067359-202067381 CACTAGATCCAGGCTGCCCTGGG - Intergenic
920036737 1:203070719-203070741 CTGTGGATACTGGTTGTCCCTGG - Intronic
920492803 1:206430682-206430704 CACTGGATACAGCATGGCCAAGG + Intronic
921899641 1:220436735-220436757 CGCTGGAAACAGGTAGCACCTGG + Intergenic
924323299 1:242870743-242870765 CACCTGATACAGGTGGCCCTTGG + Intergenic
924387494 1:243512778-243512800 CACTAGAAAGAGGTTGCCCGAGG - Intronic
924648546 1:245902499-245902521 CACTGGAGATGGGTTGACCCAGG - Intronic
1062802641 10:391460-391482 CACCAGATACAGGTGGCTCCAGG + Intronic
1067155778 10:43780154-43780176 CACTGGCTGCAGGTGGGCCCAGG - Intergenic
1075118191 10:119644653-119644675 CACTAGATGCAGGTTGTCCCTGG + Intergenic
1076073964 10:127517414-127517436 CACTGGTTAAAGGGTGGCCCTGG - Intergenic
1076488939 10:130843391-130843413 CACTTGGTACAGATTCCCCCAGG - Intergenic
1076711274 10:132336197-132336219 CACTGGAATCAGCTTGCCCTGGG + Intronic
1077560872 11:3259891-3259913 AACTGGATGGAGGCTGCCCCTGG - Intergenic
1077566769 11:3305721-3305743 AACTGGATGGAGGCTGCCCCTGG - Intergenic
1077928588 11:6707258-6707280 CTCTGGATACAGGCTACCCCAGG + Intergenic
1078636068 11:13051448-13051470 CACTGGATGTAGGCTGCCTCTGG - Intergenic
1080950155 11:37022425-37022447 CACGAGATACAGGCTGCTCCAGG + Intergenic
1085472126 11:76765077-76765099 CTCTGGATGCAGGCTGGCCCTGG + Intergenic
1087735831 11:101832279-101832301 CATGGGATGCAGGCTGCCCCAGG - Intronic
1088500613 11:110478760-110478782 GTCTGGATACAGGTTTCCACTGG - Intergenic
1089116071 11:116096245-116096267 CACTGGATGCAACCTGCCCCAGG + Intergenic
1089683793 11:120134161-120134183 CACTGGAAACATGCTGACCCAGG + Intronic
1092158602 12:6302175-6302197 CAGTGGATACAGGCAGCCCCAGG + Intergenic
1094020069 12:25904664-25904686 CACTGGATGCTGGCTGCCCTAGG - Intergenic
1095495451 12:42779345-42779367 GACTGGATCCAGCTTGCCCAAGG + Intergenic
1097428455 12:59474216-59474238 ACCTGGTTACAGGTTGTCCCAGG - Intergenic
1099945003 12:89234183-89234205 CACTGGCTCCACGTTGCCCAAGG - Intergenic
1100391918 12:94150869-94150891 CAAGCGATACAGGTTTCCCCTGG + Intronic
1102882235 12:116494382-116494404 CACTGGATACAGGCTGAACTGGG + Intergenic
1103194801 12:119034255-119034277 CATTGAAAACAGGCTGCCCCAGG + Intronic
1104143015 12:126006452-126006474 CACTGGCTATGGGTTGCTCCAGG - Intergenic
1105762645 13:23528197-23528219 CCCTGGTTACAGGCTGTCCCAGG - Intergenic
1107449699 13:40497403-40497425 CACTGGGTGCAGACTGCCCCAGG + Intergenic
1110048221 13:70858981-70859003 CAGTGGATGCAGGTTGCCCAGGG - Intergenic
1112016296 13:95334193-95334215 CACAGGCCACAGGTTGGCCCAGG - Intergenic
1112071056 13:95850924-95850946 CATTGGATATGGGCTGCCCCAGG - Intronic
1113045770 13:106153057-106153079 CAGTGGGTACAGGATTCCCCAGG - Intergenic
1113551348 13:111195425-111195447 ACCTGGTTACAGGCTGCCCCAGG + Intronic
1116334237 14:43636811-43636833 CACTGGATATGGGCTTCCCCTGG + Intergenic
1119532130 14:75369743-75369765 CACTGGATATGGGCTGCCCCAGG - Intergenic
1119755461 14:77114836-77114858 CCCTGGGCACAGGTTGCACCTGG + Exonic
1120431754 14:84426970-84426992 CACTGGTTGCAGGTGGCCCCTGG + Intergenic
1120693360 14:87617966-87617988 CACTGGATAAAGGTTATACCAGG + Intergenic
1122987509 14:105219340-105219362 CACTAAATAGAGGCTGCCCCGGG - Intronic
1125539533 15:40461988-40462010 CACTGGGTACAGGGCACCCCAGG - Exonic
1125731873 15:41896935-41896957 CCCTGGATCCAGGTTGAACCGGG - Exonic
1127960326 15:63885693-63885715 CACTCAGAACAGGTTGCCCCAGG + Intergenic
1128227862 15:66014787-66014809 CACTGGCTACAAGTTGCTACAGG - Intronic
1133535785 16:6701207-6701229 CATTGGATGCAAGTTGCCCCAGG + Intronic
1133843155 16:9428612-9428634 CATTGGATATAGGCTGCCCCTGG + Intergenic
1135665774 16:24334565-24334587 GAGTGGAGACAGGTTTCCCCAGG - Intronic
1135910368 16:26555280-26555302 AAGTGGATACAGGTTGACACTGG - Intergenic
1136065508 16:27755581-27755603 CACTGGCTATGGGCTGCCCCTGG + Intronic
1136124269 16:28166110-28166132 CACTGGATTCATGTTGGCCAAGG - Intronic
1138376882 16:56570307-56570329 CAGTGGAAACAGCTTGGCCCTGG + Intergenic
1139282315 16:65781236-65781258 CACAGCACACAGGATGCCCCAGG + Intergenic
1141467309 16:84214850-84214872 CACTGGATAGAGGCTGGCGCTGG + Intergenic
1141918028 16:87113646-87113668 CACAAGATACAGGTTGCTCCTGG - Intronic
1144967492 17:19087286-19087308 AAATGGAAACAGGTGGCCCCTGG + Intergenic
1144980427 17:19164779-19164801 AAATGGAAACAGGTGGCCCCTGG - Intergenic
1144987795 17:19213453-19213475 AAATGGAAACAGGTGGCCCCTGG + Intergenic
1145804251 17:27715144-27715166 ACCTGGTTACAGGCTGCCCCAGG - Intergenic
1148054593 17:44786672-44786694 CACTGGCTCCATGTGGCCCCAGG + Intergenic
1148141901 17:45334906-45334928 CACTGGATACTGGCTACCTCTGG + Intergenic
1148282473 17:46359609-46359631 CACTGGATACTGGCTGGGCCTGG - Intronic
1148304691 17:46577534-46577556 CACTGGATACTGGCTGGGCCTGG - Intronic
1150264985 17:63826536-63826558 CACTCGCCACAGGTTGCTCCTGG - Intronic
1150698083 17:67423271-67423293 CACTGGATACAAGTTGAATCAGG + Intronic
1151413907 17:73949052-73949074 CTCTGGGTACAGGCTGTCCCTGG - Intergenic
1152185663 17:78855087-78855109 CACTGGTTCCAGGCTGCCCTTGG + Exonic
1154060604 18:11056201-11056223 CATTGGGTCCAGGCTGCCCCTGG + Intronic
1162381492 19:10334305-10334327 CTCGGGGTACGGGTTGCCCCTGG + Exonic
1163661527 19:18580796-18580818 ACCTGGTTACAGGTTGTCCCAGG - Intronic
1167667052 19:50828390-50828412 CACTGGATACAGGTTCAGACAGG + Intronic
925178398 2:1800582-1800604 CACTGGACACAGTTTTCCCAAGG - Intronic
928418918 2:31122180-31122202 CACTGGACACAGGGGGCTCCGGG + Intronic
928730564 2:34227016-34227038 CACTGGAGTCAGTTTTCCCCAGG - Intergenic
929523159 2:42673778-42673800 TATTGGATGCAGGTTGCTCCAGG + Intronic
932394973 2:71437699-71437721 CACTGCTGACAGGTTTCCCCAGG + Intergenic
934728801 2:96642961-96642983 CACTGAATCCATGTTGCCTCTGG - Intergenic
934844149 2:97651275-97651297 CACTGGATTCAGGTTACGCATGG + Intergenic
935873779 2:107484110-107484132 CCCAGGCTAAAGGTTGCCCCAGG - Intergenic
936126004 2:109789692-109789714 CACTGAACTCAGGTTTCCCCTGG - Intergenic
936218689 2:110581776-110581798 CACTGAACTCAGGTTTCCCCTGG + Intergenic
937232502 2:120406261-120406283 CACTGGTTACACCTGGCCCCTGG + Intergenic
937236514 2:120434600-120434622 CACTGGACAGAGGCTGCCCCGGG + Intergenic
942068670 2:172295804-172295826 CTCTGGATGCAGGCTGCCCGGGG - Intergenic
943683094 2:190788472-190788494 CACTGTCTCCAGTTTGCCCCTGG - Intergenic
945479037 2:210323062-210323084 CACTGGTTCCAGCTTGGCCCTGG - Intergenic
948589223 2:239038729-239038751 CACTGGATTCAGGGTCCCCCTGG + Intergenic
1168758145 20:329998-330020 CACCAGATACAGGCTGCCCCAGG - Exonic
1168801063 20:643403-643425 CATTTGATACAGGGTCCCCCAGG + Intergenic
1168863004 20:1059648-1059670 CACCAAATACAGGTTGCCCCAGG + Intergenic
1170718086 20:18849223-18849245 AATTGGATGCAGGTTGCCCCTGG - Intergenic
1172638246 20:36424331-36424353 TATTGGATGCAGGGTGCCCCTGG + Intronic
1172969518 20:38863154-38863176 CCCTGGATGCAAGTTGCCTCTGG + Intronic
1173531407 20:43772512-43772534 CACTAGCTACTGGTTGCCACTGG + Intergenic
1173894242 20:46538242-46538264 CACTGGCTGCAGGATGCTCCTGG - Intergenic
1174563824 20:51450306-51450328 CAGTTGATACATGCTGCCCCAGG - Intronic
1174922703 20:54721925-54721947 CACTTGGTTCAGGTTGCCCTTGG - Intergenic
1174930161 20:54804801-54804823 CACTGGCTAAAGGCTGCCCCTGG + Intergenic
1174978255 20:55360161-55360183 CACTGGAGACAGATAGCTCCTGG + Intergenic
1175274551 20:57759251-57759273 CAATGGCTACAACTTGCCCCAGG + Intergenic
1175605712 20:60310762-60310784 CAATGGAGACAGATGGCCCCGGG - Intergenic
1179255340 21:39711017-39711039 CACTGGATGCAGGCTACCCCTGG + Intergenic
1180319648 22:11308391-11308413 CACTGTGTGCAGGTTGCCCAAGG + Intergenic
1182997507 22:34827690-34827712 CATTGGATAAAGGACGCCCCTGG + Intergenic
949403778 3:3693635-3693657 CACTGGTTGAAGGTTGTCCCTGG + Intergenic
952212442 3:31241759-31241781 CACTGGATGAGGGCTGCCCCAGG - Intergenic
952826703 3:37530500-37530522 CCCTGGAGATAGGTGGCCCCAGG + Intronic
953405248 3:42656685-42656707 GCCTGGAGACAGGTGGCCCCTGG + Intronic
953579878 3:44144249-44144271 CACTGGCTAAAGGTAGCCTCCGG - Intergenic
955826930 3:62957324-62957346 CATTGGATATAGGTTTCCCCAGG + Intergenic
956042151 3:65155847-65155869 CACTGGATAAAGTTTTCCTCTGG - Intergenic
958856777 3:99394841-99394863 CACTGGGTGCAGACTGCCCCAGG + Intergenic
962437439 3:135380087-135380109 CACTGGGTAGAGGCTGCCCCAGG - Intergenic
962653315 3:137517688-137517710 CCCTGGAGGAAGGTTGCCCCAGG - Intergenic
962901792 3:139768017-139768039 CACTGGATAGAAGTTGCTCCAGG - Intergenic
964064644 3:152563178-152563200 ACCTGGTTACAGGTTGTCCCAGG - Intergenic
967752365 3:193128870-193128892 CTCTGGATACAGGATGATCCGGG + Intergenic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
973576899 4:52298678-52298700 ATGTGGATACATGTTGCCCCTGG - Intergenic
981550618 4:145937786-145937808 CCCTGGCTAAAGGTTGCGCCGGG - Intronic
981632408 4:146835685-146835707 GACTGAAGACAGGTTTCCCCAGG + Intronic
982877424 4:160665710-160665732 ACCTGGATACAGGATGTCCCAGG - Intergenic
986024711 5:3840006-3840028 CCATGAATACAGTTTGCCCCTGG - Intergenic
987908543 5:24111322-24111344 CACTAGATACAGGTTACAGCTGG - Intronic
989641861 5:43590511-43590533 CACTGGAAAAGGGCTGCCCCAGG + Intergenic
992021792 5:72632100-72632122 CATGGGATACAGGCTGCCTCAGG + Intergenic
992455324 5:76910858-76910880 AACTGGTTACAGGCTGTCCCAGG - Intronic
992706017 5:79393578-79393600 CACTGGATATTGGTACCCCCTGG - Intronic
996318097 5:122183707-122183729 CACTGGATCCAGAATGGCCCTGG - Intergenic
996331599 5:122335806-122335828 GAATGAATACAGGCTGCCCCAGG + Intronic
997767981 5:136524379-136524401 CACTGGATACAGTAAGGCCCAGG - Intergenic
1000765399 5:165283146-165283168 CATTGGATGCAGGCTGCCCCCGG - Intergenic
1005209072 6:23440117-23440139 CATTTTATACAGGTTGCCCATGG + Intergenic
1006372705 6:33655313-33655335 CACTGGATAGGGGCTGCCCCTGG + Intronic
1008068887 6:47079430-47079452 CATTGGCTGCAGGCTGCCCCTGG + Intergenic
1008077143 6:47156765-47156787 CACTGGATACAGGCTGACCCAGG + Intergenic
1008236367 6:49056834-49056856 CACTAGAAACAGATTGCCTCAGG - Intergenic
1012043215 6:94237141-94237163 CATTGGATACAGGCTGCCTCAGG + Intergenic
1013907729 6:115237787-115237809 ACCTGGTTACAGGCTGCCCCAGG + Intergenic
1014254735 6:119149512-119149534 GCCAGGATTCAGGTTGCCCCCGG - Intergenic
1015896347 6:138020645-138020667 CACGGAATACAGGTGGCCTCTGG - Intergenic
1019306984 7:340294-340316 CACTGGCCTGAGGTTGCCCCTGG + Intergenic
1019308997 7:349861-349883 CCCTGGATGCAGGCTGGCCCTGG + Intergenic
1019526187 7:1481558-1481580 CACTGCACACAGGCAGCCCCAGG - Intronic
1020332460 7:7033291-7033313 CTCTGAATACATGTTGCCACTGG - Intergenic
1021338939 7:19439386-19439408 CACTGGAAACAGGGTGTCCTGGG - Intergenic
1022607367 7:31828718-31828740 CAATGGCCACAGGTTGACCCAGG - Intronic
1022693124 7:32677590-32677612 CATTGGATGCAGATTGCCCTTGG - Intergenic
1023172021 7:37399091-37399113 CTCTGGATCCAGGTGGCTCCTGG - Intronic
1023566257 7:41526549-41526571 CCCTGGAGGCAGGCTGCCCCAGG - Intergenic
1023823019 7:43990505-43990527 CTCAGGATCCAGGCTGCCCCAGG + Intergenic
1029576750 7:101408388-101408410 CACAGGATGGAGGGTGCCCCAGG + Intronic
1029751278 7:102543929-102543951 CTCAGGATCCAGGCTGCCCCAGG + Intronic
1029769230 7:102643034-102643056 CTCAGGATCCAGGCTGCCCCAGG + Intronic
1030946704 7:115732172-115732194 CACTGGATAAAGATTCCCCTGGG - Intergenic
1033967111 7:146989373-146989395 CACTGGATACAGGTTGCCCCAGG + Intronic
1034989716 7:155540724-155540746 CACTGGATACAGGATGACCAGGG - Intergenic
1035018741 7:155788145-155788167 CAATGTATTCAGGTTTCCCCAGG + Intergenic
1036782901 8:11662015-11662037 CACTGGAAGCAGGTTCTCCCAGG - Intergenic
1037277814 8:17200306-17200328 CACTGGTTGAGGGTTGCCCCTGG - Intronic
1038122102 8:24628892-24628914 CACTTGATTCAGGTCTCCCCTGG - Intergenic
1038374102 8:27020904-27020926 AACTTGATACAGGTTGCTGCTGG + Intergenic
1038891241 8:31726815-31726837 CATGGGATACAGGATGCCCCAGG + Intronic
1041760991 8:61366179-61366201 CTCTGGATAGAGATTGCACCAGG - Intronic
1047283255 8:123464250-123464272 CAATGGATGCAGGTTGCCCCTGG + Intronic
1047441659 8:124884290-124884312 CATTGGATGCAGGTTGCCAAGGG + Intergenic
1047442355 8:124889276-124889298 CACTGAATGCAAGGTGCCCCAGG + Intergenic
1048589304 8:135806314-135806336 TCCTGTATACAGGTGGCCCCAGG + Intergenic
1059141274 9:111855657-111855679 CATTGGATATGGGTTGCCCTAGG + Intergenic
1059393610 9:114016931-114016953 CACTGTAGACAGGTGGCCCTGGG - Intronic
1060400168 9:123344051-123344073 CACTGGCCACAGGCTGTCCCTGG + Intergenic
1187519405 X:20000502-20000524 CATCAGATACAGGCTGCCCCAGG + Intergenic
1187631990 X:21183457-21183479 CACTGGATGCAGGTTGACTCTGG - Intergenic
1187699897 X:21955357-21955379 CAGAGGACACAGGTTGGCCCTGG - Intronic
1188559972 X:31456434-31456456 TACATGATAGAGGTTGCCCCTGG - Intronic
1188972610 X:36636157-36636179 CACTGGATGTGGGTTGCCACTGG - Intergenic
1189225669 X:39411278-39411300 CATTGGATGTAGGCTGCCCCAGG + Intergenic
1189578507 X:42381299-42381321 CATTTGATGCAGGTTACCCCTGG + Intergenic
1189887655 X:45564675-45564697 CACTGGCTAAAGGCTGTCCCAGG - Intergenic
1193880403 X:86914012-86914034 CATTGGATATGAGTTGCCCCAGG - Intergenic
1195363889 X:104109298-104109320 CTCTGGATACAGGCAGCCCTGGG + Intronic
1196978408 X:121185097-121185119 CATTGGATATGGGCTGCCCCAGG + Intergenic
1197161023 X:123321986-123322008 CATTGGATGCAGGATACCCCAGG + Intronic
1200800918 Y:7386529-7386551 CCCTGGTTACAGGCTGTCCCAGG + Intergenic
1201515866 Y:14818365-14818387 GCCTGGTTACAGGCTGCCCCAGG + Intronic