ID: 1033967111

View in Genome Browser
Species Human (GRCh38)
Location 7:146989373-146989395
Sequence CACTGGATACAGGTTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033967108_1033967111 -9 Left 1033967108 7:146989359-146989381 CCACTTTGGCCAGTCACTGGATA 0: 1
1: 0
2: 2
3: 15
4: 146
Right 1033967111 7:146989373-146989395 CACTGGATACAGGTTGCCCCAGG 0: 1
1: 0
2: 2
3: 26
4: 171
1033967104_1033967111 26 Left 1033967104 7:146989324-146989346 CCTGTGTTGGGGTGATGGGACTG 0: 1
1: 0
2: 4
3: 18
4: 307
Right 1033967111 7:146989373-146989395 CACTGGATACAGGTTGCCCCAGG 0: 1
1: 0
2: 2
3: 26
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033967111 Original CRISPR CACTGGATACAGGTTGCCCC AGG Intronic