ID: 1033967115 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:146989393-146989415 |
| Sequence | AGGAAACAAGTAGTAGATGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1033967108_1033967115 | 11 | Left | 1033967108 | 7:146989359-146989381 | CCACTTTGGCCAGTCACTGGATA | 0: 1 1: 0 2: 2 3: 15 4: 146 |
||
| Right | 1033967115 | 7:146989393-146989415 | AGGAAACAAGTAGTAGATGTAGG | No data | ||||
| 1033967110_1033967115 | 2 | Left | 1033967110 | 7:146989368-146989390 | CCAGTCACTGGATACAGGTTGCC | No data | ||
| Right | 1033967115 | 7:146989393-146989415 | AGGAAACAAGTAGTAGATGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1033967115 | Original CRISPR | AGGAAACAAGTAGTAGATGT AGG | Intronic | ||