ID: 1033971956

View in Genome Browser
Species Human (GRCh38)
Location 7:147052450-147052472
Sequence ATTCTTTTATTGGTGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033971951_1033971956 14 Left 1033971951 7:147052413-147052435 CCTCAGTGAAAACTGATTACTAT 0: 1
1: 0
2: 2
3: 18
4: 209
Right 1033971956 7:147052450-147052472 ATTCTTTTATTGGTGGAACAGGG No data
1033971950_1033971956 15 Left 1033971950 7:147052412-147052434 CCCTCAGTGAAAACTGATTACTA 0: 1
1: 0
2: 3
3: 13
4: 192
Right 1033971956 7:147052450-147052472 ATTCTTTTATTGGTGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033971956 Original CRISPR ATTCTTTTATTGGTGGAACA GGG Intronic
No off target data available for this crispr