ID: 1033971956 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:147052450-147052472 |
| Sequence | ATTCTTTTATTGGTGGAACA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1033971951_1033971956 | 14 | Left | 1033971951 | 7:147052413-147052435 | CCTCAGTGAAAACTGATTACTAT | 0: 1 1: 0 2: 2 3: 18 4: 209 |
||
| Right | 1033971956 | 7:147052450-147052472 | ATTCTTTTATTGGTGGAACAGGG | No data | ||||
| 1033971950_1033971956 | 15 | Left | 1033971950 | 7:147052412-147052434 | CCCTCAGTGAAAACTGATTACTA | 0: 1 1: 0 2: 3 3: 13 4: 192 |
||
| Right | 1033971956 | 7:147052450-147052472 | ATTCTTTTATTGGTGGAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1033971956 | Original CRISPR | ATTCTTTTATTGGTGGAACA GGG | Intronic | ||
| No off target data available for this crispr | |||||