ID: 1033974081

View in Genome Browser
Species Human (GRCh38)
Location 7:147078473-147078495
Sequence AAGCTGTTACTGATTAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033974076_1033974081 12 Left 1033974076 7:147078438-147078460 CCCGATGACTGTTTTTCTCCCAT 0: 1
1: 0
2: 3
3: 20
4: 259
Right 1033974081 7:147078473-147078495 AAGCTGTTACTGATTAGACAGGG No data
1033974075_1033974081 13 Left 1033974075 7:147078437-147078459 CCCCGATGACTGTTTTTCTCCCA 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1033974081 7:147078473-147078495 AAGCTGTTACTGATTAGACAGGG No data
1033974077_1033974081 11 Left 1033974077 7:147078439-147078461 CCGATGACTGTTTTTCTCCCATC 0: 1
1: 0
2: 1
3: 29
4: 689
Right 1033974081 7:147078473-147078495 AAGCTGTTACTGATTAGACAGGG No data
1033974074_1033974081 23 Left 1033974074 7:147078427-147078449 CCATCTGGAGCCCCGATGACTGT 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1033974081 7:147078473-147078495 AAGCTGTTACTGATTAGACAGGG No data
1033974078_1033974081 -6 Left 1033974078 7:147078456-147078478 CCCATCTCATGCTTGATAAGCTG 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1033974081 7:147078473-147078495 AAGCTGTTACTGATTAGACAGGG No data
1033974079_1033974081 -7 Left 1033974079 7:147078457-147078479 CCATCTCATGCTTGATAAGCTGT 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1033974081 7:147078473-147078495 AAGCTGTTACTGATTAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033974081 Original CRISPR AAGCTGTTACTGATTAGACA GGG Intronic
No off target data available for this crispr