ID: 1033974509

View in Genome Browser
Species Human (GRCh38)
Location 7:147083205-147083227
Sequence GTAAAATCAAGGCTTGTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033974501_1033974509 22 Left 1033974501 7:147083160-147083182 CCCTTGAATTATATGAGGACTGG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1033974509 7:147083205-147083227 GTAAAATCAAGGCTTGTCTGAGG No data
1033974503_1033974509 21 Left 1033974503 7:147083161-147083183 CCTTGAATTATATGAGGACTGGA 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1033974509 7:147083205-147083227 GTAAAATCAAGGCTTGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033974509 Original CRISPR GTAAAATCAAGGCTTGTCTG AGG Intronic
No off target data available for this crispr