ID: 1033974904

View in Genome Browser
Species Human (GRCh38)
Location 7:147089076-147089098
Sequence CCTGGCTGTCCGCCCAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033974899_1033974904 -4 Left 1033974899 7:147089057-147089079 CCCAGCAATTTGTTAGGATCCTG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1033974904 7:147089076-147089098 CCTGGCTGTCCGCCCAAGATGGG No data
1033974900_1033974904 -5 Left 1033974900 7:147089058-147089080 CCAGCAATTTGTTAGGATCCTGG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1033974904 7:147089076-147089098 CCTGGCTGTCCGCCCAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033974904 Original CRISPR CCTGGCTGTCCGCCCAAGAT GGG Intronic