ID: 1033977166

View in Genome Browser
Species Human (GRCh38)
Location 7:147116513-147116535
Sequence CAGCTGGGACAACCTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033977148_1033977166 30 Left 1033977148 7:147116460-147116482 CCCTTCAGGCACTTTGTCCCGTG 0: 1
1: 0
2: 1
3: 7
4: 87
Right 1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG 0: 1
1: 0
2: 2
3: 17
4: 260
1033977149_1033977166 29 Left 1033977149 7:147116461-147116483 CCTTCAGGCACTTTGTCCCGTGG 0: 1
1: 0
2: 2
3: 13
4: 107
Right 1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG 0: 1
1: 0
2: 2
3: 17
4: 260
1033977156_1033977166 12 Left 1033977156 7:147116478-147116500 CCGTGGAGAACACAGGCAGGGGT 0: 1
1: 0
2: 2
3: 43
4: 382
Right 1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG 0: 1
1: 0
2: 2
3: 17
4: 260
1033977154_1033977166 13 Left 1033977154 7:147116477-147116499 CCCGTGGAGAACACAGGCAGGGG 0: 1
1: 0
2: 0
3: 39
4: 297
Right 1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG 0: 1
1: 0
2: 2
3: 17
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033977166 Original CRISPR CAGCTGGGACAACCTGCCCT GGG Intronic
900358132 1:2274571-2274593 CCGCTGGGACTTCCTGCCATGGG - Intronic
900500287 1:3001196-3001218 CACCTGTGACAATCTGCCCCTGG + Intergenic
900967793 1:5971280-5971302 CAGCTGAGACAAGCAGCTCTGGG - Intronic
901284966 1:8070707-8070729 CAGCTGTGGCAACCGACCCTAGG + Intergenic
901755427 1:11438837-11438859 CAGCTGAGGCCACCTGCCCTGGG - Intergenic
902765800 1:18614194-18614216 CAGCTGGGAGGCCATGCCCTGGG + Intergenic
903153473 1:21429107-21429129 CAGCTGGGCCCGCTTGCCCTCGG - Intergenic
904571791 1:31471509-31471531 CAGCAGGGACTACCTGCACCAGG - Intergenic
908845973 1:68324536-68324558 CCTCTTGGACAACTTGCCCTGGG - Intergenic
910034033 1:82768470-82768492 CATCATGGAGAACCTGCCCTTGG - Intergenic
910259910 1:85284568-85284590 CTGTTGGGACAACCTGCCTGTGG + Intergenic
912956140 1:114155090-114155112 CATCTGTGCCAACCGGCCCTTGG + Intergenic
913468999 1:119171647-119171669 CAGCTGGCCCCACCTGCCCCAGG + Intergenic
915535114 1:156530768-156530790 CAGCGGGCCCAACCTGCCCCTGG + Intronic
915542389 1:156576078-156576100 CAGCTGGGTTAGCCTGCCTTGGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
917854517 1:179089920-179089942 CAGCTTGGAAAACCTCACCTGGG + Intronic
919805122 1:201376892-201376914 CCACTGGGAGAACCTGTCCTTGG - Intronic
919924145 1:202183592-202183614 CAGCTGGGTCAGCCTGACCCTGG - Intergenic
919996293 1:202754226-202754248 CAGCTGGGAGAAACTGCCTAGGG + Intronic
920377503 1:205517050-205517072 CTGCTGGGACAACCTGTGCCAGG - Intronic
922200138 1:223394141-223394163 CAGCCGGGACTCCCAGCCCTTGG + Exonic
924653151 1:245948799-245948821 CAGGTGGGTTAACCTGTCCTAGG - Intronic
1062968828 10:1630382-1630404 CAGCGGTGACACCCTTCCCTGGG + Intronic
1063573010 10:7233881-7233903 CAGCTGGCAGAACCTGTCCCAGG + Intronic
1064392575 10:14954360-14954382 CGGCTGGGGCCACCTGCTCTGGG - Intronic
1065284803 10:24176986-24177008 CAGCTGGCACCACCGGCCCCGGG - Intronic
1066337016 10:34488448-34488470 CAGCTGGGACCACAGGCACTGGG + Intronic
1067463366 10:46474899-46474921 CAGCTGGGGCTAGCTGACCTAGG + Intergenic
1067623828 10:47909739-47909761 CAGCTGGGGCTAGCTGACCTAGG - Intergenic
1067702393 10:48583277-48583299 CAGCTGGGCCTACTTCCCCTTGG + Intronic
1069951939 10:72025053-72025075 CAGAAGCGACCACCTGCCCTTGG + Intergenic
1070153638 10:73820119-73820141 GAGCTGGGAGAGCATGCCCTGGG - Intronic
1072899155 10:99392147-99392169 CAGCTGAGACATACTGCCCCAGG - Exonic
1073285189 10:102383182-102383204 CACGTGAGACAACCTGGCCTAGG + Intergenic
1074154967 10:110790016-110790038 CAGATGGGCCACCCTGACCTGGG + Intronic
1074238127 10:111606993-111607015 CAGCTGGCTCAACTTTCCCTAGG + Intergenic
1074947568 10:118296207-118296229 CAGGTGGGAAAACCATCCCTAGG - Intergenic
1075275133 10:121086327-121086349 CAACTGGGAGAACGTGCTCTGGG - Intergenic
1075715724 10:124554115-124554137 CAGCTGGGACGACCTGGGCCAGG + Intronic
1076183799 10:128431141-128431163 CTGCTGGAACAAGCAGCCCTGGG - Intergenic
1076941696 10:133614475-133614497 AAGCTGGGAAAACCTGGACTGGG - Intergenic
1076941781 10:133614973-133614995 CAGCTGTGAACACCTGGCCTGGG - Intergenic
1076942130 10:133616934-133616956 CAGCTGTGAACACCTGGCCTGGG - Intergenic
1076942507 10:133619137-133619159 CAGCTGTGAACACCTGGCCTGGG - Intergenic
1077297351 11:1832412-1832434 CTGCTGGGAAAACCTTCTCTGGG - Intronic
1077392171 11:2305187-2305209 CTGCCGGGCCAACCAGCCCTGGG + Intronic
1078109548 11:8381646-8381668 CAGCTGGAACACCCTGTCCCTGG + Intergenic
1079763379 11:24357905-24357927 TAGTAGGGACAACCTCCCCTTGG - Intergenic
1083125693 11:60563798-60563820 CAGATGGGGAAACCTGCCCAGGG - Intergenic
1084358052 11:68652436-68652458 CCCCTGGGACACCCTGGCCTTGG + Intergenic
1084439183 11:69161477-69161499 CAGCTGAGTCAAGCTGTCCTTGG + Intergenic
1085015484 11:73171189-73171211 CAGCGGGGAAAACATGACCTAGG - Intergenic
1086552650 11:88070034-88070056 CAGCAGAGGCAACCTGCTCTGGG + Intergenic
1088823328 11:113474781-113474803 CAGCTGGGGCAGCCTCCCCGCGG - Intronic
1090347437 11:126082778-126082800 CGGCTGGGGCTGCCTGCCCTGGG - Intergenic
1090358689 11:126157983-126158005 CTGCTGGAAAACCCTGCCCTGGG - Intergenic
1093125477 12:15322890-15322912 CGGCTGGGCCATCGTGCCCTGGG - Intronic
1093722570 12:22461925-22461947 CTGCTGGGACCAGCTGGCCTTGG - Intronic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1101775417 12:107788917-107788939 CAGATGAGAGAACCTGCCCAGGG - Intergenic
1101988295 12:109464270-109464292 CAGGTTGGAGACCCTGCCCTAGG - Intronic
1104583231 12:130026292-130026314 CAGCTGGGACTACATGCACGTGG + Intergenic
1105616057 13:22013716-22013738 CAGGTGAGAGAAACTGCCCTGGG - Intergenic
1105837588 13:24224367-24224389 CAGCTGGCACTTCCTGCCCCGGG - Exonic
1112457792 13:99577493-99577515 GAGCTGGGCCATCCTTCCCTAGG - Intergenic
1113472174 13:110554950-110554972 CAGCTTGGTCTTCCTGCCCTTGG - Intronic
1113474663 13:110571911-110571933 CAGCTGGGAGCCTCTGCCCTGGG - Intergenic
1113915121 13:113865865-113865887 CATCTGGGACAATCTGCACCTGG + Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1116901114 14:50362873-50362895 CAGCAGTGGCAACCTACCCTGGG + Intronic
1118219000 14:63837786-63837808 CAGCTGGGACTACAGGCCCATGG - Intergenic
1118725082 14:68623251-68623273 TAGCTGGGCCAACTTTCCCTGGG - Intronic
1119389461 14:74281154-74281176 TTGTTGGGACAGCCTGCCCTTGG - Intergenic
1120834569 14:89027908-89027930 GAGCTGGGACACACAGCCCTGGG - Intergenic
1121124238 14:91395695-91395717 CAGCTGGGCAATCCTGGCCTGGG - Intronic
1122048463 14:99039590-99039612 GGGCTGGCACGACCTGCCCTTGG + Intergenic
1122059121 14:99124805-99124827 CAGGTGGGAAATGCTGCCCTGGG + Intergenic
1122074322 14:99226105-99226127 ATGCTGGGACCACCGGCCCTTGG + Intronic
1122126091 14:99579515-99579537 CAGCTGGGAACACATGCCCTGGG - Intronic
1122210515 14:100170858-100170880 CAGCTGGACCAGGCTGCCCTGGG + Intergenic
1122332477 14:100932348-100932370 CAGCCGGGGCAACCTGACCTCGG - Intergenic
1122538881 14:102485630-102485652 AGGCTGGGACAAGCTTCCCTAGG - Intronic
1122612427 14:102994642-102994664 CAGCTGGGAGAAAATGCACTTGG - Intronic
1202854485 14_GL000225v1_random:42358-42380 CAGCAGGGAGAAACTGGCCTGGG - Intergenic
1124664040 15:31576506-31576528 AAGGTGGGACAACTTGACCTGGG - Intronic
1124717992 15:32084672-32084694 CAGTTTGGACCAGCTGCCCTGGG + Intronic
1125796120 15:42405139-42405161 CAGCTGTGGCAGGCTGCCCTGGG - Intronic
1126143413 15:45455374-45455396 CAGCTGGGACAGCCAGCCCCCGG - Intergenic
1126350670 15:47742066-47742088 CAGCTGAGGCCTCCTGCCCTTGG - Intronic
1128220347 15:65964376-65964398 CTGCTGGGACAACCCTCCTTAGG + Intronic
1128799317 15:70487462-70487484 CAGCTGGGCACACCTGCCTTGGG + Intergenic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129680718 15:77657029-77657051 CAGCTGGTAGGAGCTGCCCTGGG - Intronic
1130317631 15:82809954-82809976 CAGCTGGGCCGGCCTGCTCTCGG + Exonic
1130335172 15:82952317-82952339 CAGCAGGGGCACCCTGGCCTGGG - Intronic
1132338289 15:101062787-101062809 CACCTAGGACCACCTGGCCTAGG + Intronic
1132623987 16:881411-881433 CAGCTGGGACACTCAGCCCGCGG + Intronic
1132761467 16:1510506-1510528 CAGCTGGGACACCCGGGCCTTGG - Exonic
1132891967 16:2209010-2209032 CTGCTGGGCCAGGCTGCCCTGGG + Exonic
1133050156 16:3112867-3112889 CAGCTGCAACCACCTGCCCCAGG - Exonic
1133244304 16:4437448-4437470 CAGCTGGGAGAACTTCTCCTTGG - Exonic
1133572947 16:7059798-7059820 CAGCTGGCAGAAGCAGCCCTGGG - Intronic
1135848508 16:25940955-25940977 CAGCAAGGACAAACAGCCCTGGG - Intronic
1136143485 16:28301853-28301875 CAGGTGGCACAAACTGCCCAAGG + Intronic
1138396051 16:56705555-56705577 CAGCAGGGAGGGCCTGCCCTGGG + Intronic
1139403141 16:66697323-66697345 CGGCGGGGACAACCTGCAGTGGG - Intergenic
1139559104 16:67730364-67730386 CAGCTGGGGCAACATGATCTGGG + Intronic
1141679356 16:85535376-85535398 CAGATGGGAAACCCTGGCCTCGG + Intergenic
1143064875 17:4239056-4239078 CAGCTTCTAAAACCTGCCCTAGG - Intronic
1143532683 17:7514210-7514232 CAGCACGGGCAAGCTGCCCTGGG - Exonic
1144630990 17:16872416-16872438 CAGCTGGGAGAAGCAGCCCAAGG - Intergenic
1144650324 17:17003060-17003082 CAGCTGGGAGAAGCAGCCCAAGG + Intergenic
1145951631 17:28822925-28822947 TAGCTGGGACTACCTGCGCATGG - Intronic
1147214236 17:38890215-38890237 CAGCTGGGACTGGCTGACCTGGG - Intronic
1148583628 17:48761210-48761232 CTGCTGGGATAACCAGGCCTTGG + Intergenic
1149034683 17:52120635-52120657 CAGCTGGGGGAACCTGCACAGGG + Intronic
1149543961 17:57489369-57489391 CAGCTGGGAGCACCTGCTCCTGG - Intronic
1151299046 17:73208304-73208326 CCGGGGGGACAACCTGCCATTGG - Exonic
1151819794 17:76491291-76491313 CAGCTGGGATGGCCTGGCCTTGG - Intronic
1152255570 17:79237482-79237504 CAGATGGGGTAACCTGCTCTGGG - Intronic
1152579571 17:81160059-81160081 CAGCCGGGGCCACCTGCCCCAGG - Intronic
1153631668 18:7076331-7076353 CTAGTGGGACAACCAGCCCTGGG + Intronic
1155169717 18:23258392-23258414 CAGCTGGGACAAACTGCGTTTGG + Exonic
1155304863 18:24469177-24469199 CAGTTGGGACAACTTGCCTTGGG - Intronic
1155340844 18:24812636-24812658 CAGCTGGGAGGCCCTCCCCTAGG - Intergenic
1155990440 18:32274045-32274067 CAGCTGTGCCCACCTGCCGTGGG - Intronic
1160024510 18:75207139-75207161 CTGGTGGGACCACCTGCCTTTGG - Intronic
1161286754 19:3472292-3472314 CAGCTGAGACCCCCTGACCTTGG - Intergenic
1162263037 19:9547906-9547928 CGGCTGGCACCACCAGCCCTGGG + Intergenic
1163692953 19:18746967-18746989 CAGCCGGGGCTTCCTGCCCTGGG + Intronic
1163806738 19:19404068-19404090 CATCTGGCACAACCTCCCCTAGG - Intronic
1164854820 19:31512654-31512676 CAGCTGAGACCACCTTCCCAAGG - Intergenic
1165061964 19:33209209-33209231 CTGCTAGGACACCCTGCTCTGGG + Intronic
1165064569 19:33221497-33221519 AAACTGAGGCAACCTGCCCTGGG - Intronic
1165832490 19:38736478-38736500 GGGCTTGGTCAACCTGCCCTGGG - Intronic
1165832497 19:38736499-38736521 GGGCTTGGTCAACCTGCCCTGGG - Intronic
1167498234 19:49831378-49831400 CAGCTGGGAGCCCCAGCCCTCGG + Exonic
1168322614 19:55518855-55518877 CAGCTGGTAGAAGCTGCCCGGGG + Exonic
1168639245 19:58019873-58019895 CAGCTGGGACACTCTGCACATGG - Intergenic
925389996 2:3488101-3488123 CAGCTTGAAGAACCTGCCCACGG + Intergenic
926315211 2:11704728-11704750 CAGCTGGGATCCCCAGCCCTGGG + Intronic
927471920 2:23384031-23384053 CAGCTGGGAGGAGCTGGCCTGGG - Intergenic
934713210 2:96528790-96528812 CAGCTGAGACAAGCTGGCCAGGG + Intergenic
937099075 2:119254763-119254785 CAGCAGGGACAACGTGCCGAGGG - Exonic
938063356 2:128268570-128268592 CAGCTGGGCCCGCTTGCCCTCGG + Exonic
938766628 2:134464234-134464256 CAGCAGGGGCCACCTTCCCTGGG + Intronic
939085662 2:137715895-137715917 CAGCTGGCACCACCAGCCCCAGG + Intergenic
940309161 2:152258903-152258925 TAGCTGGGACTACCGGCCCGTGG + Intergenic
942947636 2:181686910-181686932 CTGCTGGGAGCACCTGCCATGGG + Intergenic
946058362 2:216920303-216920325 CAGCTGGGAGGACCAGCCATGGG + Intergenic
947551113 2:231047519-231047541 CTGGAGGGACAACCTGCCCCTGG - Exonic
948529914 2:238597848-238597870 GCCTTGGGACAACCTGCCCTAGG - Intergenic
948909666 2:240996705-240996727 CAGCGGAGAAATCCTGCCCTGGG + Intergenic
1168954524 20:1825835-1825857 CAGCTGGACCTACCTGACCTGGG - Intergenic
1170787511 20:19480409-19480431 CAGCTGAGCCATCCTGCCTTTGG + Intronic
1171102244 20:22394999-22395021 CACCTGGTGCATCCTGCCCTTGG + Intergenic
1171750497 20:29044361-29044383 CAGCAGGGAGATCCTGCCCGTGG + Intergenic
1172079249 20:32326300-32326322 CAGCTTGGACAACGAGCCATGGG + Intronic
1172134264 20:32676382-32676404 CAGCTGGGACTCAGTGCCCTGGG - Intergenic
1172351991 20:34250248-34250270 CAACTCTGACAGCCTGCCCTGGG - Intronic
1173246545 20:41341239-41341261 AAGCTGGGCCAGCCTCCCCTGGG - Intronic
1173736959 20:45368746-45368768 CAGCTGGGATGACCTTCCCTGGG + Exonic
1174417432 20:50376861-50376883 CTGCTGGGACACCATGGCCTGGG - Intergenic
1175427421 20:58877433-58877455 CAACTAGGAGAACCAGCCCTGGG - Intronic
1175894624 20:62330663-62330685 CCCCCTGGACAACCTGCCCTGGG + Intronic
1176173472 20:63707080-63707102 CAGCGTGTACATCCTGCCCTGGG + Exonic
1176261417 20:64182801-64182823 TTGCTGGGACCTCCTGCCCTAGG + Intronic
1176314713 21:5231554-5231576 CAGCAGGGAGATCCTGCCCATGG - Intergenic
1176372905 21:6073333-6073355 CAGCTGGGCCACCCTCCCGTCGG + Intergenic
1176671028 21:9735637-9735659 CAGCTGGCACCACCAGCCCCAGG + Intergenic
1179302895 21:40128404-40128426 CACATGGCACAACCTGCCCATGG - Intronic
1179750572 21:43464910-43464932 CAGCTGGGCCACCCTCCCGTCGG - Intergenic
1184365732 22:44050040-44050062 CGGCTGGGGCAACCCTCCCTAGG - Intronic
1184803032 22:46774120-46774142 CTGCTGGGCCTGCCTGCCCTTGG + Intronic
1184982078 22:48101976-48101998 CAGCTGGGCCGTCCTGCCCAGGG + Intergenic
950204866 3:11071484-11071506 CAGCCGGCACCACCGGCCCTAGG - Intergenic
952750989 3:36824739-36824761 CAGATGATACAACTTGCCCTGGG - Intergenic
953983887 3:47426867-47426889 CAGCTGGGGATGCCTGCCCTAGG + Intronic
954306214 3:49726823-49726845 CAGCAGGGACAGGGTGCCCTTGG - Exonic
955472343 3:59298670-59298692 GACCTGGGACAACCTGCCGCCGG - Intergenic
956544994 3:70391123-70391145 CAGCTGAGACTATATGCCCTAGG + Intergenic
958678057 3:97292587-97292609 TTGCTGGGACAACCTGCCTGTGG - Intronic
959703698 3:109321137-109321159 TAGCTGGGACAACATGCTCATGG + Intergenic
960694706 3:120384977-120384999 GAGCAGAGAAAACCTGCCCTAGG + Intergenic
960864997 3:122190485-122190507 GAGGTTGGACAACCTGCCCAAGG - Intronic
960995841 3:123339543-123339565 CAACAGGGAGAGCCTGCCCTGGG + Intronic
961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG + Intronic
961911218 3:130318434-130318456 CATCTGGGAAAACTTGACCTTGG + Intergenic
964544855 3:157822620-157822642 CAGTTGGAACACTCTGCCCTGGG + Intergenic
965433717 3:168620977-168620999 CCACTGGGAAAACCTGTCCTGGG - Intergenic
969652946 4:8478413-8478435 CAGCTGGTAGAAACAGCCCTTGG + Intronic
974480085 4:62431731-62431753 CAGCTGAGGGAACCTGCCCAGGG - Intergenic
974619891 4:64341049-64341071 ATGATGGGACAACCTGCCCATGG + Intronic
981527394 4:145720278-145720300 CTGCTGGGAAAAGCTGGCCTGGG - Intronic
981750817 4:148091120-148091142 CATCTGGCGCACCCTGCCCTGGG + Intronic
983033705 4:162836222-162836244 CAGCAGTGGCAACCTGCCCAGGG - Intergenic
984995493 4:185426347-185426369 GAGCTGGGGCAACCTGATCTCGG + Intronic
986318510 5:6608289-6608311 GAGATGGGAGAACATGCCCTTGG - Intronic
987234365 5:15928188-15928210 CCGCTGGTACAACCTGGCCTGGG + Exonic
988128428 5:27073316-27073338 CAGCTGGGAGGTCCTGCCCAGGG - Intronic
990999453 5:61768200-61768222 CAGATGGGACAACCAGTCCTAGG - Intergenic
994110502 5:95997824-95997846 CAGTTGGGGTACCCTGCCCTTGG - Intergenic
996027094 5:118658278-118658300 CATCTGGGACCACCTCCACTTGG + Intergenic
999375899 5:151086317-151086339 CAGCTGTGTCTGCCTGCCCTTGG + Intronic
1000149800 5:158488506-158488528 CATCTTGGACAGCCTGCCCAAGG - Intergenic
1001149905 5:169218139-169218161 CAGCTGGTACAAACAGTCCTTGG - Intronic
1001985771 5:176073610-176073632 AAGCTGGGAAAACCTGGGCTGGG - Intronic
1001985860 5:176074108-176074130 CAGCTGTGAACACCTGGCCTGGG - Intronic
1002231011 5:177764016-177764038 CAGCTGTGAACACCTGGCCTGGG + Intronic
1002231100 5:177764514-177764536 AAGCTGGGAAAACCTGGGCTGGG + Intronic
1002264238 5:178019234-178019256 AAGCTGGGAAAACCTGGGCTGGG - Intronic
1002264327 5:178019732-178019754 CAGCTGTGAACACCTGGCCTGGG - Intronic
1004372300 6:15063092-15063114 CAGTTGGGATAACCAGCCGTGGG + Intergenic
1006922155 6:37634124-37634146 CAGCTGGGCTATCCTGCCCTTGG - Exonic
1008844824 6:55950410-55950432 TTGCTGGTACCACCTGCCCTGGG + Intergenic
1009739267 6:67723153-67723175 CAGCTGGCACCACCGGCCCCAGG + Intergenic
1010270361 6:73910088-73910110 CAGCTGGCACCACCGGCCCTGGG + Intergenic
1012632058 6:101482830-101482852 CAGCTGGTATAACCTTCTCTGGG + Intronic
1013366451 6:109441301-109441323 CTGCTGGGACCACCGGCGCTGGG - Intronic
1013796482 6:113894798-113894820 AAGCTGGGAAAAGCTGACCTGGG + Intergenic
1015618608 6:135105931-135105953 CATCTGGGACAAGCTGCTGTGGG + Intergenic
1016251352 6:142047266-142047288 TAGCTGGGAGAACCTGAACTAGG - Intergenic
1021887526 7:25154502-25154524 CAGCTGGGAGAACCTGCTCCAGG + Intronic
1022356879 7:29624144-29624166 CAGCTGAGTCAGCCTGCCCTCGG + Intergenic
1022469341 7:30672637-30672659 CAGCTGGGTCAGCCTACCCATGG - Intronic
1023042525 7:36184489-36184511 CACCTGGGAATACCAGCCCTGGG + Intronic
1024397858 7:48889831-48889853 CAGATGAGAAAACCTGCCCAGGG + Intergenic
1025253207 7:57365675-57365697 CTGCTGGGACACCATGGCCTGGG + Intergenic
1026130241 7:67614222-67614244 CAGCTGGGACCACCATCCCTGGG - Intergenic
1027229478 7:76263904-76263926 AAGCAGGGACATCATGCCCTTGG + Intronic
1027279006 7:76591815-76591837 CAGTTGGTACAATCAGCCCTGGG - Intergenic
1032457742 7:132086725-132086747 CTGCTGGGAGCACCTGCCCCTGG + Intergenic
1032466995 7:132152297-132152319 CAGCTGACTCAACCTGACCTTGG - Intronic
1032572428 7:133014481-133014503 CTGCTGGGACAATTTGCCGTTGG - Intronic
1033278303 7:139988906-139988928 CAGCTGGGACTACCTACCAATGG - Intronic
1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG + Intronic
1035016873 7:155774267-155774289 CAGCTGCCCCAACCTGCTCTGGG - Intronic
1035089347 7:156293905-156293927 AAACTGGGACACCCTTCCCTGGG - Intergenic
1035962952 8:4157779-4157801 CAGCTGGGTGAACTTGCCCAGGG + Intronic
1037485170 8:19340107-19340129 CAGCTGGAACTGCCAGCCCTAGG - Intronic
1038141140 8:24846514-24846536 AAACTGGGACATCATGCCCTAGG + Intergenic
1039411640 8:37359977-37359999 CAGCCAGGACTGCCTGCCCTAGG + Intergenic
1039889345 8:41673662-41673684 CAGCTGGGACAAGCAGCTCAGGG - Intronic
1039901168 8:41753511-41753533 CAACTGGGACAGCGTGCCCCTGG - Intronic
1040543132 8:48377107-48377129 CACCCGGGACAACCTGCCCTTGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1044024760 8:87155006-87155028 CAGCTGGGAGCACCTGCTCCAGG + Intronic
1045523639 8:102925024-102925046 CAGCTGTGTCAAACTGCCTTGGG - Intronic
1046511694 8:115212059-115212081 CAGATGCGACCTCCTGCCCTTGG + Intergenic
1047318695 8:123758188-123758210 CTGCAGGGACATCCAGCCCTGGG - Intergenic
1049024465 8:139979273-139979295 CCGGTGGGACCACCTGCCCCAGG + Intronic
1049268395 8:141681582-141681604 CTGCTGGGGCCACCCGCCCTGGG - Intergenic
1049622336 8:143604314-143604336 CAACTGAGTCAGCCTGCCCTGGG + Exonic
1051698866 9:19797608-19797630 GAGCTTAGAGAACCTGCCCTGGG - Intergenic
1053284800 9:36843262-36843284 CATCTAGGTCTACCTGCCCTGGG + Intronic
1053872540 9:42507522-42507544 CAGCAGGGTCCACCTGCTCTGGG + Intergenic
1057074797 9:92132828-92132850 CAGCTGGGTCAGCCTGACCCTGG - Intergenic
1058379583 9:104363161-104363183 CAGCTGGCACCACCAGCCCCGGG - Intergenic
1058971127 9:110083994-110084016 CAGCTGGGAGTTCCCGCCCTAGG - Intronic
1060027390 9:120184762-120184784 CACCTTGGACAACTTGCCTTTGG - Intergenic
1060247205 9:121957047-121957069 CAGCTGGGCCAACATGCAGTGGG - Intronic
1060814949 9:126630295-126630317 CGGGTGCCACAACCTGCCCTTGG + Intronic
1060819848 9:126654977-126654999 CAGCTGTGACACCCAGTCCTGGG + Intronic
1061189932 9:129076516-129076538 CAGCTCGGGCAGCCTCCCCTGGG + Intergenic
1061357684 9:130118869-130118891 CAGCTGGGTGTGCCTGCCCTTGG - Intronic
1062190979 9:135247729-135247751 CAGCAGGGCCAATCTGGCCTGGG - Intergenic
1062191470 9:135249936-135249958 CGGCTGGGAGCCCCTGCCCTGGG - Intergenic
1062407760 9:136404994-136405016 CAGCCGGTGCAGCCTGCCCTTGG - Intronic
1189717515 X:43881628-43881650 CAGCTTGGCCACCCTGCGCTAGG + Intronic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1192318558 X:70069757-70069779 CAGCTGGGGCAGACAGCCCTGGG - Intergenic
1194173496 X:90618018-90618040 CAGCTGGCACCGCCAGCCCTGGG - Intergenic
1195470011 X:105220175-105220197 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1195732659 X:107981905-107981927 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1196462650 X:115946156-115946178 CAGCTGGGACCACAGGCACTTGG + Intergenic
1200519716 Y:4195710-4195732 CAGCTGGCACAACCAGCCCTGGG - Intergenic
1201177864 Y:11321124-11321146 CAGCAGGGAGAAACTGGCCTGGG - Intergenic
1202368051 Y:24180084-24180106 CAGCTGGGCCAGCATGCACTGGG + Intergenic
1202502734 Y:25490033-25490055 CAGCTGGGCCAGCATGCACTGGG - Intergenic