ID: 1033987873

View in Genome Browser
Species Human (GRCh38)
Location 7:147248617-147248639
Sequence AAGTTGAGACTACTCTAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033987872_1033987873 12 Left 1033987872 7:147248582-147248604 CCGGTGGCTGTCATGGCAGTTTG 0: 1
1: 0
2: 2
3: 15
4: 141
Right 1033987873 7:147248617-147248639 AAGTTGAGACTACTCTAGTTTGG No data
1033987870_1033987873 22 Left 1033987870 7:147248572-147248594 CCTTATGGGGCCGGTGGCTGTCA 0: 1
1: 0
2: 1
3: 18
4: 139
Right 1033987873 7:147248617-147248639 AAGTTGAGACTACTCTAGTTTGG No data
1033987869_1033987873 23 Left 1033987869 7:147248571-147248593 CCCTTATGGGGCCGGTGGCTGTC 0: 1
1: 0
2: 0
3: 0
4: 57
Right 1033987873 7:147248617-147248639 AAGTTGAGACTACTCTAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033987873 Original CRISPR AAGTTGAGACTACTCTAGTT TGG Intronic
No off target data available for this crispr