ID: 1033987978

View in Genome Browser
Species Human (GRCh38)
Location 7:147250015-147250037
Sequence GATTCTGATGTGCCTCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033987978 Original CRISPR GATTCTGATGTGCCTCCAAT GGG (reversed) Intronic
900791637 1:4684637-4684659 GCTTCTCACGTGCCTCCAAATGG + Intronic
908173844 1:61534377-61534399 GATTATTAAGTGCCACCAATTGG + Intergenic
908535759 1:65075521-65075543 GCCTCTGATGTGCCTCCCTTTGG + Intergenic
916449820 1:164909790-164909812 CATTCCAATGTGCTTCCAATGGG + Intergenic
917043051 1:170827772-170827794 GTTTCTGATGTTGCTCCTATAGG + Intergenic
917717925 1:177756756-177756778 TATTCTGATGTGCAGCCAATTGG + Intergenic
917962989 1:180159061-180159083 GATTCTGCTGAGCCCCCACTGGG - Intronic
918050836 1:180971270-180971292 TTTTCTGATGGGCCTCCAATGGG + Intergenic
920133286 1:203749518-203749540 GATTCTGATGTGCAGCTGATTGG + Intergenic
1064956547 10:20917407-20917429 GCTTCTGTTGTGACGCCAATGGG - Intronic
1067578087 10:47420340-47420362 GATGCAGATGTGGCTCCATTTGG + Intergenic
1072159971 10:92757056-92757078 AATCCTGATATCCCTCCAATGGG - Intergenic
1075099982 10:119499308-119499330 GATTATGATGTGTCCCCGATGGG + Intergenic
1086560732 11:88166051-88166073 GATTTGGATGTGCTTCCAAAGGG + Intronic
1086756690 11:90572826-90572848 AATTCAGATGTGACTCCATTTGG + Intergenic
1087656583 11:100930474-100930496 AATTCTTATGTGCCTTCCATAGG + Intronic
1092127332 12:6084210-6084232 TATTCTCATTTGCCTGCAATCGG + Intronic
1093560615 12:20534417-20534439 GATTATGATCTACCTCTAATGGG + Intronic
1098082459 12:66803279-66803301 GTTTATGATGTGCCCCAAATGGG - Intronic
1098140215 12:67443352-67443374 GATGCTGATGTGGCTCTAGTCGG + Intergenic
1103966201 12:124641491-124641513 TCTTCTGATGGGCCTCCCATTGG + Intergenic
1107342226 13:39420150-39420172 GAGTGTGATGTGCCTCAATTAGG - Intronic
1108522951 13:51261304-51261326 GATACTAATGTGCCTGCCATGGG + Intronic
1108685007 13:52811762-52811784 GATTCTGATGTCACTAAAATGGG - Intergenic
1108884242 13:55159704-55159726 GATTCTCATGTTCCTGCATTGGG + Intergenic
1111040109 13:82737111-82737133 AATTCTGCTGTGACTCCACTGGG + Intergenic
1111761471 13:92471147-92471169 GATTCTGATGTAAGTCCTATAGG + Intronic
1112664638 13:101555743-101555765 AATTCTTATCTGGCTCCAATTGG + Intronic
1113633298 13:111902685-111902707 GATTCTGATGAGCCTCAGAGAGG + Intergenic
1118336140 14:64854920-64854942 GCTGCTGATGCCCCTCCAATGGG + Intronic
1120827810 14:88970885-88970907 GATGCTGCTGCTCCTCCAATAGG - Intergenic
1121325635 14:93018130-93018152 TCTTCTGCTGTGCCTCCAGTTGG - Intronic
1126897404 15:53273720-53273742 GACTCTAAAGTGACTCCAATAGG - Intergenic
1139876671 16:70151563-70151585 GATTCTGAAGTGCCACCCAGTGG + Intronic
1147256326 17:39184519-39184541 GAGTCTGAGGGGCCTCCACTGGG + Intronic
1150743506 17:67798324-67798346 GATTCTGATCTGCATCCCTTAGG + Intergenic
1165000777 19:32759967-32759989 GATTCTGATATGCCTCTTGTAGG + Intronic
1166326027 19:42051670-42051692 GATTCAGATGTGACTCAAACTGG - Intronic
925779944 2:7372922-7372944 GATTATGATTTGGCTCCCATGGG - Intergenic
926019353 2:9481779-9481801 GATGCTGATGTGCCTTGACTTGG + Intronic
926723268 2:15978619-15978641 GATTCTGATCTGCCTCCCAGCGG - Intergenic
929786440 2:44996676-44996698 GATTCTCCTGTGCCTCCTGTTGG + Intergenic
931650769 2:64466777-64466799 GATTCAAATGTGCCTTCAGTTGG + Intergenic
936484033 2:112911340-112911362 AATTCAGATGTGCTTCCAGTGGG - Intergenic
938510440 2:131936724-131936746 GCTTCAGATGTGGCTCCAAAGGG - Intergenic
1170836738 20:19891238-19891260 TACTCTCATTTGCCTCCAATGGG - Intronic
1172151862 20:32796457-32796479 GATTTTGTGGTGACTCCAATTGG - Intronic
1179598623 21:42460750-42460772 GATTCTGATGGGACTCCCAGGGG + Intergenic
1182030099 22:27152045-27152067 CATTCTCATGTGCTTCTAATAGG + Intergenic
949121983 3:396431-396453 TTTTCTCATGTGCTTCCAATTGG - Intronic
949919723 3:8991221-8991243 GATTCTGAGGGGCTTCTAATTGG + Intronic
950297961 3:11848217-11848239 GAATGTAATGTCCCTCCAATGGG + Intergenic
952002263 3:28799695-28799717 TATTCTGATGTGGGTCCTATTGG + Intergenic
956912728 3:73835983-73836005 GACTCTAATGTGCCTCAAAGAGG - Intergenic
959468304 3:106717719-106717741 GATACTGATTTGGCTGCAATAGG + Intergenic
959491342 3:106992137-106992159 GATTATGATGTGCCTCAGAGAGG - Intergenic
963928481 3:150977176-150977198 GATTTTGATTTTCCTCCAAATGG + Intergenic
966826752 3:183971496-183971518 CATGCTGATCTGCCACCAATAGG - Intronic
973739131 4:53902137-53902159 GATGCTGATGTGCCTAGAACTGG - Intronic
977146876 4:93453393-93453415 GATTCTGATATGCCTCCCACAGG + Intronic
981784295 4:148460599-148460621 GAATCTGATGTTCCTTCAGTTGG - Intergenic
983403669 4:167297928-167297950 GATTCTGTTGAGTCTCCAAATGG - Intergenic
989296440 5:39832707-39832729 AATTCTGATGGGATTCCAATTGG + Intergenic
991953126 5:71966056-71966078 ACTTCTGCTGTGTCTCCAATAGG + Intergenic
994502096 5:100591801-100591823 GATTCTGTTGTAACTCCAAATGG + Intergenic
995655003 5:114416219-114416241 GTTCCTGACTTGCCTCCAATGGG + Intronic
997645611 5:135479562-135479584 TGTTCTGATGTGCCTCCACCTGG + Intergenic
1003506964 6:6748133-6748155 GAATCTGATTTGCCACTAATTGG - Intergenic
1006723060 6:36172694-36172716 GAGCCAGCTGTGCCTCCAATTGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007125184 6:39419868-39419890 GGTCATGATGTGCCTCCAAATGG - Intronic
1009679057 6:66868279-66868301 GATTCTTCTGTGCTTGCAATGGG - Intergenic
1015944142 6:138482904-138482926 GATTCTGATGTACCTTAATTTGG - Intronic
1016452650 6:144198955-144198977 TATTCTGTTTTGCCTCCTATAGG + Intergenic
1029988421 7:104941788-104941810 GATTCTGATCTGCTTCCACCCGG - Intergenic
1031575422 7:123410207-123410229 GGTTCTGATTTGCCTGGAATTGG + Intergenic
1033987978 7:147250015-147250037 GATTCTGATGTGCCTCCAATGGG - Intronic
1036590741 8:10165750-10165772 GACTCTGCAATGCCTCCAATTGG - Intronic
1045655565 8:104383171-104383193 GATTCTGATGTGCCTGGCCTGGG - Intronic
1053448789 9:38175238-38175260 GATACTGAGGTGCCTAGAATAGG + Intergenic
1055499635 9:76889965-76889987 GATTCCCAGGTGACTCCAATAGG + Intronic
1058436912 9:104971482-104971504 GTTTCAGCTGTGCCTGCAATTGG + Intergenic
1059129671 9:111733478-111733500 GATTCTGATATGGCAACAATTGG - Intronic
1059626789 9:116075523-116075545 CATCCTGCTTTGCCTCCAATAGG + Intergenic
1185494155 X:541564-541586 TATTCTGATGTGTCTCGCATGGG + Intergenic
1186472928 X:9835408-9835430 CATTCTAATGTGCTTCCAAGGGG - Intronic
1196960040 X:120991377-120991399 GAATTGGATGAGCCTCCAATGGG + Intergenic
1197868069 X:131039228-131039250 GATTCTGATGTGCCCACAATTGG + Intergenic
1198184494 X:134240087-134240109 GATTCTGACCTGCCCCCTATAGG - Intronic