ID: 1033989305

View in Genome Browser
Species Human (GRCh38)
Location 7:147264566-147264588
Sequence CCCTCTGATGGAGCTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 201}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033989302_1033989305 -5 Left 1033989302 7:147264548-147264570 CCACTAGGGCATATCAAACCCTC 0: 1
1: 0
2: 1
3: 3
4: 65
Right 1033989305 7:147264566-147264588 CCCTCTGATGGAGCTGCTCCAGG 0: 1
1: 0
2: 5
3: 24
4: 201
1033989300_1033989305 2 Left 1033989300 7:147264541-147264563 CCTGTGCCCACTAGGGCATATCA 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1033989305 7:147264566-147264588 CCCTCTGATGGAGCTGCTCCAGG 0: 1
1: 0
2: 5
3: 24
4: 201
1033989295_1033989305 23 Left 1033989295 7:147264520-147264542 CCACTTACTGGTCCCTGCGGGCC 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1033989305 7:147264566-147264588 CCCTCTGATGGAGCTGCTCCAGG 0: 1
1: 0
2: 5
3: 24
4: 201
1033989296_1033989305 11 Left 1033989296 7:147264532-147264554 CCCTGCGGGCCTGTGCCCACTAG No data
Right 1033989305 7:147264566-147264588 CCCTCTGATGGAGCTGCTCCAGG 0: 1
1: 0
2: 5
3: 24
4: 201
1033989297_1033989305 10 Left 1033989297 7:147264533-147264555 CCTGCGGGCCTGTGCCCACTAGG No data
Right 1033989305 7:147264566-147264588 CCCTCTGATGGAGCTGCTCCAGG 0: 1
1: 0
2: 5
3: 24
4: 201
1033989301_1033989305 -4 Left 1033989301 7:147264547-147264569 CCCACTAGGGCATATCAAACCCT No data
Right 1033989305 7:147264566-147264588 CCCTCTGATGGAGCTGCTCCAGG 0: 1
1: 0
2: 5
3: 24
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033989305 Original CRISPR CCCTCTGATGGAGCTGCTCC AGG Intronic