ID: 1033990800

View in Genome Browser
Species Human (GRCh38)
Location 7:147283939-147283961
Sequence GTATCTTAGTAAAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033990800 Original CRISPR GTATCTTAGTAAAGGGAAGA TGG (reversed) Intronic
901364484 1:8734161-8734183 GTATCAAAGTAAAGGCAAGAAGG - Intronic
901531973 1:9859362-9859384 GGAGCTTAGAAAAGGGAAGCTGG + Intronic
905592960 1:39180713-39180735 CTACCTTAGTAAAAGGAAGAAGG - Intronic
907831149 1:58065472-58065494 ATATTTTAGTAAAGGGAACTGGG + Intronic
909255358 1:73414008-73414030 GAAACTTAGTGAAGTGAAGATGG - Intergenic
911976415 1:104502447-104502469 GTAACAAAGAAAAGGGAAGATGG + Intergenic
912197641 1:107418051-107418073 GTTTCTCAGAAAAGGAAAGAGGG - Intronic
912558892 1:110536152-110536174 GGAGCTAAGCAAAGGGAAGAGGG + Intergenic
913301372 1:117373389-117373411 ATGTCTGAGTAAAGGGAAGTGGG - Intronic
917106004 1:171492698-171492720 GTTTCTTATTAAAAGCAAGAGGG + Intronic
917508109 1:175647491-175647513 GAAGCAAAGTAAAGGGAAGAGGG + Intronic
917872835 1:179257073-179257095 GTGTCTAAGTAAATTGAAGACGG - Intergenic
918788344 1:188793770-188793792 ATATCTTAATAAAGGGAGAAAGG + Intergenic
920379155 1:205525934-205525956 GCATGTCAGTAAAGGGAGGAAGG + Intronic
922087477 1:222364675-222364697 GTATCCTATTAAAGGTGAGATGG + Intergenic
924381943 1:243473763-243473785 GTAACTTTGTAAAGAGAGGAAGG + Intronic
1066481236 10:35797547-35797569 TTATCTGAGTAAAGGGATGGAGG + Intergenic
1069332986 10:67315412-67315434 GTATCTCAGTAACGGGGAGGGGG + Intronic
1069985147 10:72277846-72277868 GTCTCACAGTAAAGGGAAGAGGG + Intergenic
1070224768 10:74491463-74491485 GAATCTCAGTAATGGGTAGATGG - Intronic
1071370287 10:84944329-84944351 GAAGGTTAGTAAAGGGAAGAAGG - Intergenic
1072242530 10:93510411-93510433 GAATTTTAGTAAAGGGGATATGG - Intronic
1073310342 10:102535625-102535647 GTATCAGAAGAAAGGGAAGAGGG - Intronic
1074847970 10:117415470-117415492 GAATCTTAGTGAAGGGTATATGG - Intergenic
1074893065 10:117751325-117751347 CTAACATAGTACAGGGAAGATGG - Intergenic
1077718113 11:4601183-4601205 TTATCTTAGTACAGGGAAGAGGG + Intronic
1078137409 11:8662804-8662826 TCATTTTAGGAAAGGGAAGAGGG - Intronic
1079361347 11:19772997-19773019 GTTTCTTAGTGAAGAAAAGAAGG + Intronic
1080159972 11:29162074-29162096 ACATATTAGTAAAGGGAGGAAGG - Intergenic
1081890166 11:46534673-46534695 GTCTCTCAGAAAAAGGAAGAGGG - Intronic
1084082736 11:66839467-66839489 GTATCTGGGTCAAGGGAAGCTGG + Intronic
1086425092 11:86675015-86675037 GTCTATTACTAAAAGGAAGAAGG + Intergenic
1088856459 11:113759307-113759329 GAATATTAGTTAAGAGAAGAGGG - Intronic
1091136550 11:133196089-133196111 GTGTCTTAGCAAATTGAAGAAGG + Intronic
1093990571 12:25585604-25585626 GTATTTTATTAAAGTGAAGAGGG - Intronic
1094534248 12:31306961-31306983 GTATCTTACTTGAGGGGAGAAGG - Intronic
1097218403 12:57431510-57431532 GTATCTTAGAGAGGGGATGATGG - Intergenic
1098550848 12:71759525-71759547 GTTTCTTACTCAAGGGAAGGAGG - Intronic
1100556320 12:95697522-95697544 GAATCTTAGTATAGGAAAGATGG - Intronic
1100790517 12:98125167-98125189 GTATTTTGGTAAGGGGTAGATGG - Intergenic
1101307078 12:103538974-103538996 TTATCTCAGAAAAGCGAAGAAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107007945 13:35636036-35636058 ATATTTTACTCAAGGGAAGAAGG + Intronic
1108833160 13:54504693-54504715 GTATCTTTGTGAAGGAAGGATGG + Intergenic
1108948549 13:56057366-56057388 GTATCTTGGTAAATGGAGAACGG - Intergenic
1109507585 13:63325975-63325997 TTATCTTAAAAAAAGGAAGAAGG - Intergenic
1109893050 13:68643828-68643850 GTAGGGTAGTAAAGGGAAGTAGG + Intergenic
1110245663 13:73321262-73321284 GTAAATTAGTAAATGTAAGAAGG + Intergenic
1110301832 13:73937642-73937664 GTACATTGCTAAAGGGAAGAAGG + Intronic
1110860763 13:80342253-80342275 GACTTTTAGTTAAGGGAAGAAGG - Intergenic
1111024612 13:82502883-82502905 GTAACAAAGAAAAGGGAAGATGG + Intergenic
1111314386 13:86533937-86533959 GTATCTTCATAAAGGCAATATGG - Intergenic
1111935629 13:94554457-94554479 GTATCTGAGTAAAAGGTATATGG + Intergenic
1112729544 13:102345134-102345156 GTATCTCTTGAAAGGGAAGAGGG - Intronic
1114196884 14:20486017-20486039 GTGACTAAGAAAAGGGAAGATGG - Intergenic
1114975120 14:28086373-28086395 GTATATGCATAAAGGGAAGAAGG + Intergenic
1116752616 14:48905656-48905678 GTAGCTGAGTAAAGGTATGAGGG + Intergenic
1118054370 14:62063854-62063876 GTGTGTTAATAAAGGGATGAAGG + Intronic
1118203449 14:63699373-63699395 GTAAGTTTGTAAAGGGAAGAAGG + Intronic
1118704357 14:68466795-68466817 GTTATTTACTAAAGGGAAGAAGG + Intronic
1119941186 14:78643542-78643564 GTATATTTGTCAAGGTAAGAGGG - Intronic
1120632122 14:86904338-86904360 GAATCTTAGGAAAGTGATGAAGG - Intergenic
1121986562 14:98512485-98512507 GAATCTTTGTTAATGGAAGAAGG + Intergenic
1128105500 15:65041643-65041665 TTCTCTTATTAAAAGGAAGAAGG + Intergenic
1128810940 15:70572191-70572213 GTATCTTATAAGAGGGAAGCAGG + Intergenic
1130538535 15:84803899-84803921 GTAGTGGAGTAAAGGGAAGAGGG + Exonic
1132368494 15:101276457-101276479 GTCTCTTAGTAAAAGTAAGAGGG - Intronic
1133700651 16:8305318-8305340 TTCTCTTGGCAAAGGGAAGAAGG - Intergenic
1133753800 16:8746123-8746145 GTATTTTGGAAAAGGGAAAAAGG + Intronic
1134162196 16:11900607-11900629 CTATCTGAGGAAGGGGAAGATGG - Intronic
1134875601 16:17695701-17695723 GGAACTAAGTAACGGGAAGATGG + Intergenic
1136590268 16:31214339-31214361 GTATCTTGGTAAAGTGAGGGAGG + Intronic
1138763740 16:59574714-59574736 GTATCTTGCTAAAGAAAAGATGG - Intergenic
1140134167 16:72190531-72190553 GTTTCATAATAAAGGGAAGAGGG + Intergenic
1140183283 16:72742108-72742130 CCTTCCTAGTAAAGGGAAGAGGG + Intergenic
1143059556 17:4188306-4188328 GTATCTTGGTACAGGACAGAGGG - Intronic
1143978819 17:10850233-10850255 GTATCTTAAGAAAGTGAGGAGGG - Intergenic
1146457241 17:33017516-33017538 GAATCATAGTAGAGGGAAGGCGG - Intronic
1149227551 17:54492117-54492139 TTATGTTGGTCAAGGGAAGAAGG + Intergenic
1151164722 17:72193760-72193782 TCAGCTTAGTAAAGGGCAGAAGG + Intergenic
1155583996 18:27343822-27343844 GGATCTTAGTAGAGGAAACAAGG - Intergenic
1156600837 18:38604174-38604196 GTGTCTGTGTAAAGGGATGAGGG + Intergenic
1159091394 18:63853117-63853139 CTATTTTAGTAAAGGGAATGTGG - Intergenic
1160129204 18:76209325-76209347 GTCTCTTGGAGAAGGGAAGAAGG + Intergenic
1161184330 19:2906391-2906413 GTATCTTAGTAAGGACAAGCAGG + Intronic
1162103814 19:8357499-8357521 TTTTCTTAGTAAAGGGCAAAAGG + Intronic
1162962351 19:14135817-14135839 GTATCTCACTACAGGAAAGAGGG + Intronic
1163539548 19:17899365-17899387 GTATTTTAGTAGAGAGTAGAGGG + Intergenic
1163689533 19:18730978-18731000 GTCTCTTAAAAAAGGGAAGGAGG - Intronic
1165201836 19:34150957-34150979 GTATATTAAAAAAAGGAAGAAGG - Intergenic
1165371695 19:35411639-35411661 GTGTGGTATTAAAGGGAAGAAGG - Intergenic
1165784065 19:38450787-38450809 ATAACTAAATAAAGGGAAGATGG + Intronic
926103521 2:10136221-10136243 GAATCTCAATAAAGGGCAGAGGG + Intergenic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
927743613 2:25594728-25594750 GAATCTTGGTTAAGGGAAAATGG - Intronic
928761525 2:34588823-34588845 GTATCTCAATAAAGGGTTGAAGG - Intergenic
929394058 2:41501779-41501801 GTAACACAGAAAAGGGAAGATGG - Intergenic
929466744 2:42151871-42151893 AGACCTTAGTCAAGGGAAGAGGG - Intergenic
930324816 2:49902048-49902070 ATATTTTAGAAAAGGGAAGGAGG + Intergenic
932898902 2:75675354-75675376 AAATCTTGGTAAAGGGAATATGG + Intronic
937427050 2:121808831-121808853 GTATCTTTGTGGAGTGAAGAAGG + Intergenic
937827197 2:126379944-126379966 GTAACAAAGAAAAGGGAAGATGG + Intergenic
939352878 2:141063147-141063169 GTATTTAAGTCAAGGCAAGATGG - Intronic
939708792 2:145488955-145488977 GTATCATTGTAAAGGAAAGCTGG + Intergenic
940195332 2:151088132-151088154 CTATCTCAGAAAAGAGAAGATGG - Intergenic
941311270 2:163935057-163935079 GTATATTAATAAAGGGCAGTTGG + Intergenic
942258400 2:174130579-174130601 GGCTATTAGTAAAGAGAAGAAGG + Intronic
944115077 2:196177164-196177186 GTTTCTTAGCAAAGTGAAAAAGG - Intergenic
944767940 2:202883769-202883791 GAATTTTAGAAAAGGGAAGTAGG + Intronic
944827148 2:203496050-203496072 CTATTTTATTAATGGGAAGAAGG - Intronic
945226009 2:207531065-207531087 GGATCTTATAAAAGGGAAGCTGG + Intronic
945338950 2:208628376-208628398 GTATTTTTGTATAGGGAACAAGG - Intronic
945369629 2:209000957-209000979 GTATCATTGTAAATGAAAGATGG - Intergenic
947735607 2:232453403-232453425 TTATCTTGTTAAAGGGGAGATGG + Intergenic
948425263 2:237883228-237883250 GTATCTTGGTATATGGCAGAGGG + Intronic
1169524973 20:6414464-6414486 ATTTCTAAGAAAAGGGAAGAAGG + Intergenic
1170144910 20:13162855-13162877 GCATCTTAGTGACAGGAAGATGG - Intronic
1173126337 20:40339505-40339527 GTAACTTAGGAAAGGAAAGCTGG - Intergenic
1173999891 20:47366854-47366876 GAGTCTTAGTAATGGAAAGATGG - Intergenic
1175157497 20:56981421-56981443 GTATTTTAGGGAAGGGAAGGAGG - Intergenic
1178819755 21:35964220-35964242 CTATCAAAGAAAAGGGAAGATGG + Intronic
949669775 3:6386341-6386363 GTATCTTATTACTGGGAAAAAGG - Intergenic
950005235 3:9687172-9687194 GAATCTTAGAAGAGGGGAGAGGG + Intronic
950845510 3:16011866-16011888 GTTTCTTAGAAAAGGGGAGGGGG + Intergenic
951091360 3:18577270-18577292 GTATCTTAGGAAATGGGGGAAGG - Intergenic
953083078 3:39639445-39639467 TTATCTTAATAAAAGGAAAAGGG + Intergenic
956697944 3:71934506-71934528 AAAGCTTTGTAAAGGGAAGAAGG - Intergenic
958170077 3:89928098-89928120 GGAATTTATTAAAGGGAAGATGG + Intergenic
960410510 3:117317808-117317830 AAATGTTAGTGAAGGGAAGAAGG + Intergenic
962140169 3:132781999-132782021 GTCTATTACTAAAAGGAAGAAGG - Intergenic
962261349 3:133910366-133910388 GAATATTAGTAAAATGAAGAAGG - Intergenic
964873015 3:161334128-161334150 ATATCTTAGGACAGGAAAGAGGG - Intergenic
965157490 3:165082853-165082875 GTCTCTTAGTAACAGGAAGTTGG + Intergenic
966175718 3:177136006-177136028 CTATTGGAGTAAAGGGAAGATGG - Intronic
967744071 3:193035298-193035320 GTAGGTTAGTACAGGTAAGAAGG + Intergenic
968384986 4:127886-127908 GTATATTTGTAAAGGCAAAAAGG - Intronic
970052915 4:11936464-11936486 GTAACTTTTTAATGGGAAGAAGG + Intergenic
972020948 4:34313454-34313476 CTTTCATAGTAAATGGAAGATGG - Intergenic
972835131 4:42861486-42861508 CTATCTTCTTAAAGGGAGGATGG + Intergenic
973115070 4:46446722-46446744 GTATCTTTGGAAAGGGAAAGAGG + Intronic
973843290 4:54885040-54885062 GTATCTTAGTCAGGGGAATGAGG - Intergenic
974999293 4:69200454-69200476 GTTTGCTAGAAAAGGGAAGAAGG - Exonic
975006489 4:69294773-69294795 GTTTGCTAGAAAAGGGAAGAAGG + Exonic
976869224 4:89770179-89770201 GTCTTTTATTTAAGGGAAGAAGG + Intronic
977963106 4:103108119-103108141 TTATCTTAATAAAGAGCAGAGGG - Intronic
978639801 4:110856770-110856792 TCATCTCAGTAAAAGGAAGATGG + Intergenic
979655189 4:123184126-123184148 ATAACTAAGTAAAGGGAAGCTGG + Intronic
981034089 4:140152537-140152559 GTATCTTAAGAAAGGGAAGGGGG + Intronic
981450544 4:144892109-144892131 TTATATTAGTAAAGTGAAAAGGG - Intergenic
981919502 4:150071554-150071576 ATATCTTATTAATGGGAATAAGG - Intergenic
982124013 4:152168950-152168972 GGACCTTAGGAAAAGGAAGAAGG + Intergenic
982378011 4:154715926-154715948 GAAGAATAGTAAAGGGAAGAGGG - Intronic
983630480 4:169844560-169844582 AAATCTGAGTAAAGGCAAGAGGG - Intergenic
988638257 5:33011389-33011411 GCCTCTTAGGACAGGGAAGAAGG + Intergenic
990195463 5:53310252-53310274 GCATATAAGTAAATGGAAGATGG - Intergenic
990201009 5:53374365-53374387 TTATCTTTGTCAATGGAAGAAGG + Intergenic
990690152 5:58354724-58354746 ATATCTTGGTAAAGGAGAGATGG + Intergenic
991557215 5:67909123-67909145 CAATCTTAGTAAAGGAAAAAAGG + Intergenic
992820283 5:80488911-80488933 GTATATTAGTATAGGGAAATAGG + Intronic
995314430 5:110751987-110752009 GTATCCTATTAATGGGAAGAAGG + Intronic
996530613 5:124523125-124523147 GTCTCTGAGTAAAAGCAAGAAGG + Intergenic
996966242 5:129309469-129309491 GTATGTTAGTCAAGAGGAGAGGG + Intergenic
997864115 5:137445538-137445560 GTAAATGAGGAAAGGGAAGAGGG + Intronic
997989976 5:138536534-138536556 CTATCTTAGTGAGGGGGAGAAGG - Intronic
1000933939 5:167285399-167285421 ATATTTTAGTAGAGGGAAAAGGG - Intronic
1001144879 5:169175125-169175147 GTGTCTTAGTCATGGGAAGAAGG + Intronic
1001610663 5:172998835-172998857 GTACCTTATAAAAGGGAAAATGG + Intronic
1005410668 6:25542285-25542307 CTTTCTTAGGAAAGGGCAGAAGG + Intronic
1008028863 6:46670066-46670088 GTAGCTTAGGAAAGGGAATGTGG - Intronic
1008779041 6:55079365-55079387 GTATCTCAGTAAAGGGATTTTGG + Intergenic
1010800651 6:80171049-80171071 GTATCTTAGTTAACAGAACATGG + Intronic
1013515830 6:110885077-110885099 TTATCTTAGTCAAGTGAAGCAGG + Intronic
1013753435 6:113433862-113433884 GTCTCTGAGAAAAGGGAAAAAGG + Intergenic
1014450720 6:121578264-121578286 ATATTTAAGAAAAGGGAAGAAGG + Intergenic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1016375246 6:143413689-143413711 GTATCTTATTATAGTGGAGAGGG - Intergenic
1018563630 6:165128300-165128322 TTATCTTCGAAAAGGGAATAGGG - Intergenic
1019870290 7:3754664-3754686 GTTTCTAAGTAAGGGGAAGGGGG + Intronic
1020970930 7:14937650-14937672 GTATATTAGAGCAGGGAAGAGGG - Intronic
1022478012 7:30724280-30724302 GAATCTGAGTGAAGGGTAGATGG - Intronic
1022951161 7:35339492-35339514 GAATCAAAGTAAAGTGAAGATGG - Intergenic
1023310468 7:38881344-38881366 GGGTCTTTGTAAATGGAAGAGGG - Intronic
1024139192 7:46444683-46444705 GTTCCTTAGCAAAGGAAAGAGGG - Intergenic
1027815120 7:82958932-82958954 GTAACTCAGTAAAGGGAGGATGG - Intronic
1033990800 7:147283939-147283961 GTATCTTAGTAAAGGGAAGATGG - Intronic
1034744107 7:153507145-153507167 GTGTTTCAGTAAATGGAAGAAGG - Intergenic
1038338975 8:26668383-26668405 GTAACAAAGAAAAGGGAAGATGG - Intergenic
1038521885 8:28240813-28240835 GGAACTAAGTAAAGGGAACATGG + Intergenic
1039101282 8:33944688-33944710 GTTCCTAAGTAAAGGGGAGAGGG + Intergenic
1039139828 8:34374170-34374192 TTATCTTAGTAAAAGGGAGCTGG + Intergenic
1039584783 8:38697329-38697351 GCAAATTAGAAAAGGGAAGAGGG - Intergenic
1040779623 8:51092706-51092728 GTGACAAAGTAAAGGGAAGATGG - Intergenic
1040988519 8:53323125-53323147 ATATCTTTGTAAAAGGAAAATGG - Intergenic
1041692113 8:60698691-60698713 GTTTCTTAGTAAAGAGAACATGG + Intronic
1041746889 8:61217025-61217047 GTATTTTAGAAAAGAGAAGATGG - Intronic
1043279186 8:78441259-78441281 GTAACTTAATAAAAGGAGGAAGG - Intergenic
1043656257 8:82671568-82671590 ATATCTTAAGAAAGGGAAGTTGG - Intergenic
1045246505 8:100445890-100445912 ATATCATAGGAAAGGAAAGAAGG + Intergenic
1045657686 8:104403758-104403780 GTATGTTAGTAAAAGAGAGAAGG + Intronic
1045917633 8:107491461-107491483 GTCTCTTAGTAAAGTGGGGAAGG + Intronic
1045937206 8:107694564-107694586 GTATCCAAATAAAGGAAAGAGGG + Intergenic
1047018678 8:120751184-120751206 TTATCTCAGGAGAGGGAAGAAGG + Intronic
1047445457 8:124915221-124915243 GTAACAAAGTAAAGGGAAGATGG - Intergenic
1048171091 8:132107257-132107279 TACTCTTAGTAAATGGAAGAGGG - Intronic
1054968972 9:71062276-71062298 GCATTTTAATAAAGGGAAGGTGG - Intronic
1056065433 9:82928786-82928808 GTCTATTAGTAAAGGGGAGCTGG - Intergenic
1059254879 9:112920615-112920637 GTATCTGAGTTACTGGAAGAAGG - Intergenic
1059679320 9:116570941-116570963 GTATATTTTTAAAAGGAAGAAGG + Intronic
1060891550 9:127192426-127192448 GCATCTTAGGAAAGGGCAGATGG + Intronic
1061732554 9:132627381-132627403 GTTTCTTAGGAAGAGGAAGAAGG - Intronic
1062072723 9:134566525-134566547 GGACCCTAGGAAAGGGAAGAGGG - Intergenic
1187339308 X:18407164-18407186 GTATCTTAGTGAATGAAGGAAGG + Intergenic
1187893339 X:23957679-23957701 GTGTTTTAGTAAAGGCAGGAAGG - Intergenic
1188853436 X:35161249-35161271 ATTTCTTAGAAAAGGGAAGGAGG - Intergenic
1189139323 X:38584814-38584836 GTTTCTCAGGAAAGGGAAGAGGG - Intronic
1192803739 X:74492397-74492419 TTATCTAAGTAAAAGGTAGAGGG + Intronic
1194489860 X:94532180-94532202 GGATCAAAGTAAAGGGATGAAGG + Intergenic
1196464448 X:115958364-115958386 TTTTCTTAGCAAAGGGCAGAGGG - Intergenic
1200386428 X:155895470-155895492 GTATATTGGGAAGGGGAAGAGGG + Intronic
1201323012 Y:12721395-12721417 GTTTCTTAGTACAGGGATTAAGG + Intronic