ID: 1033991253

View in Genome Browser
Species Human (GRCh38)
Location 7:147290107-147290129
Sequence TATTGTGATCAGAGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 1, 2: 12, 3: 71, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033991253 Original CRISPR TATTGTGATCAGAGGCTGGC AGG (reversed) Intronic
904855733 1:33497021-33497043 TAGTGTCATAAGAGGATGGCAGG - Intergenic
905696754 1:39980262-39980284 TATTATGATCAGAGGCTCTCAGG + Intergenic
905854231 1:41297007-41297029 AATTGTAATCAGAGGGTGGTTGG + Intergenic
906477157 1:46176960-46176982 TATTGTGACCAGAGGGTTTCAGG - Intronic
907090323 1:51718187-51718209 TATGGTTACCAGAGGCTGGAAGG + Intronic
908187170 1:61663631-61663653 TCTTGTGAGCAAAGGCTTGCAGG - Intergenic
908620407 1:65973611-65973633 TATTGTGATCAGAAGACTGCAGG + Intronic
909225504 1:73015661-73015683 TGTTGTGATCAAAGGCTCACAGG + Intergenic
909652535 1:77991973-77991995 AAATGTGACCAGAGCCTGGCAGG + Intronic
909721753 1:78779059-78779081 TATTGTGACCACAGACTGTCAGG - Intergenic
911278330 1:95892267-95892289 TTTTGTGACTAGAGGCTTGCAGG - Intergenic
912268387 1:108183488-108183510 TGTTGTAATCAGAGGCTCACAGG - Intronic
912991466 1:114491422-114491444 TTTTGTGACCGGAGGCTTGCAGG - Intronic
913350195 1:117849722-117849744 TGTTGTGACCAGAGGCTCACAGG - Intergenic
915879292 1:159649334-159649356 ACTTGTGAGCACAGGCTGGCTGG + Intergenic
916157004 1:161862074-161862096 TATTGTAACCAGAGGCTTGCAGG + Intronic
917760448 1:178151486-178151508 TGTTGTGACCAGAGGCTTACAGG + Intronic
917802190 1:178581048-178581070 TCTAGGGGTCAGAGGCTGGCAGG + Intergenic
918089180 1:181273567-181273589 TGTTGTGACCAGAGGCTCTCAGG + Intergenic
919600207 1:199613080-199613102 TTCTGAGTTCAGAGGCTGGCAGG + Intergenic
920539767 1:206769553-206769575 CACTGTGTTCACAGGCTGGCCGG + Intronic
921586700 1:216955207-216955229 TATGGTTATAAGAGGCTGGGAGG - Intronic
921645274 1:217607631-217607653 TGTTGTGACCAGAGGCTTCCAGG + Intronic
922059559 1:222074821-222074843 TATTGTTAACAGAGGCTCACAGG - Intergenic
922243335 1:223771303-223771325 CCTTGTGATCAGAGTCTGGCTGG - Intronic
1062776519 10:153728-153750 TGTTGTGACCAGAGGCTCACAGG - Intronic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1063086816 10:2827109-2827131 TATTGAGACCAGAGGCTTTCAGG - Intergenic
1064432392 10:15282468-15282490 TGTTGTGACCAGAGGCTTGCAGG + Intronic
1066512362 10:36115837-36115859 TTTTGTGATCACAGATTGGCAGG + Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1067126532 10:43521191-43521213 AAATGTGGGCAGAGGCTGGCAGG - Intergenic
1069401571 10:68053201-68053223 TGTTCTGACCAGAGGCTTGCAGG - Intronic
1069653258 10:70067163-70067185 TGTTGTGACCAGAGGCTTGTAGG + Intronic
1069871083 10:71533499-71533521 AATTGTGACCCTAGGCTGGCTGG + Intronic
1070442214 10:76457768-76457790 TGTTGTGACCAGAGGCTTTCAGG + Intronic
1071181882 10:82995686-82995708 TATTCTGATCATAGGCTTGAGGG - Intergenic
1071811012 10:89180874-89180896 TCTTGTGATCAGAAGCTCTCAGG + Intergenic
1072028016 10:91483740-91483762 AAATGTGATCAGAGGCTCACAGG - Intronic
1074532551 10:114306945-114306967 TCTTGTGTTTTGAGGCTGGCAGG - Intronic
1074853477 10:117456900-117456922 TGTTGGAATCAGAGGATGGCAGG - Intergenic
1075261161 10:120964868-120964890 TGAGGTGCTCAGAGGCTGGCAGG + Intergenic
1075542473 10:123326727-123326749 TGTTGTGCCCAGAGGCTGGCAGG + Intergenic
1076535750 10:131175542-131175564 TATTGAGGTCAGAGGTGGGCAGG - Intronic
1076685018 10:132194611-132194633 TTCTGTGCTCAGAGGGTGGCTGG + Intronic
1076978596 11:193399-193421 TATTATGACCAGAGGCTTGAAGG - Intronic
1077135717 11:997301-997323 TGTGGGGATCAGAGGCTGCCTGG + Intronic
1077322594 11:1948970-1948992 GCTTGAGATGAGAGGCTGGCAGG - Intronic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1078513995 11:12008041-12008063 TATTGTCAGCAGAGGTTTGCAGG - Intronic
1078793395 11:14568039-14568061 AAATGTGACCAGAGGCTTGCAGG + Intronic
1078834005 11:15008287-15008309 TCTTGGGAACAGAGGTTGGCTGG - Intronic
1079102153 11:17548260-17548282 TATCTGGATCTGAGGCTGGCAGG + Intronic
1080351853 11:31393932-31393954 TGTTGTGAGCAGAGGCTCTCAGG - Intronic
1081116742 11:39211903-39211925 TGTTGTGACCAGAGGCTCGCAGG + Intergenic
1081160397 11:39741914-39741936 GATGGTTATCAGAGGCTGGAAGG + Intergenic
1083259417 11:61515132-61515154 TATAGAGATCTGAGGATGGCTGG + Intergenic
1084030730 11:66479358-66479380 TATGGTAAGCAGAGGCTGTCTGG + Intergenic
1084304794 11:68274991-68275013 TGTTGTGATCAGAGGTTCACAGG - Intergenic
1085764205 11:79269043-79269065 TGTTTTGATCAGAGGCTTACAGG + Intronic
1085944704 11:81254346-81254368 TGTTGTGATCTCAGGCTGGCAGG + Intergenic
1087072260 11:94092826-94092848 TATTGTGACCAGAGGTTTGCAGG + Intronic
1088174790 11:107040351-107040373 TGTTGTGACCAGAAGCTTGCAGG - Intergenic
1088562556 11:111130557-111130579 AAATGTGACCACAGGCTGGCAGG - Intergenic
1088605212 11:111523455-111523477 CATTATGACCAGCGGCTGGCAGG + Intronic
1088615620 11:111624798-111624820 TAGAGTGGTCAGAGGCTGGTTGG + Intronic
1088770481 11:113031083-113031105 TATTGTGGCCAGAGGCTCCCAGG - Intronic
1089774279 11:120825549-120825571 TTTGGTGATCACAGGCTGGTAGG - Intronic
1089801448 11:121032422-121032444 TGTTATGATCAGAGGCTCGCAGG - Intronic
1091158152 11:133393313-133393335 TGTTGTGATCAGAAGCTCACAGG + Intronic
1202805611 11_KI270721v1_random:4283-4305 GCTTGAGATGAGAGGCTGGCAGG - Intergenic
1091941284 12:4485195-4485217 TGTTGTGGTCAGAGCCTTGCAGG - Intergenic
1093504526 12:19849794-19849816 TGTTGTGACCAGAGGCTGGAAGG + Intergenic
1093609816 12:21140095-21140117 TATTGTGACCAGAGGCAGACAGG + Intronic
1093661996 12:21767825-21767847 AATTGTGATAATAGACTGGCTGG - Intronic
1093912895 12:24767562-24767584 TACTGTGACCAGAGGCTTGCAGG + Intergenic
1095643482 12:44512787-44512809 TATGGTGATCAGAAGCTAGGAGG + Intronic
1098016299 12:66108186-66108208 CTTTGAGATGAGAGGCTGGCCGG - Intergenic
1098135549 12:67397994-67398016 TATTTTGAGCAGAGGCTGGTGGG + Intergenic
1098221607 12:68275646-68275668 CATCGTGACCAGAGGCTTGCAGG - Intronic
1098988593 12:77040098-77040120 TATTGTAACCAGAGGCTCACAGG - Intronic
1100662941 12:96720039-96720061 TGTTGTGACCAGAGGCTCTCGGG + Intronic
1100873788 12:98941083-98941105 TATTGTGACCAGAGGCTTGCAGG - Intronic
1101584123 12:106069644-106069666 TATTGTGAGCAGAGGCTCTCAGG + Intronic
1102712787 12:114943143-114943165 TCCTGGGATAAGAGGCTGGCTGG - Intergenic
1102734383 12:115145317-115145339 TATTCTGAACACAGGATGGCTGG + Intergenic
1104065648 12:125303157-125303179 TGAGGTTATCAGAGGCTGGCAGG - Intronic
1106785288 13:33101561-33101583 TATTGTGACCTGAGGCTCACAGG + Intergenic
1107606946 13:42067092-42067114 TGTTGTGACCAGAGGTTTGCAGG + Intronic
1107983034 13:45751608-45751630 TTTTGTTATCAGAGCCTGACTGG - Intergenic
1108067938 13:46597865-46597887 TTTTGTGACCAGAGGCTTGCAGG + Intronic
1108317073 13:49247556-49247578 TTCTGTCATCAGAGACTGGCGGG - Intergenic
1110443061 13:75546920-75546942 TATTGTGACCACAGGCTCACAGG - Intronic
1111265793 13:85811408-85811430 TACTGTGACCAGAGGCTGGCAGG + Intergenic
1111271180 13:85888236-85888258 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1112598154 13:100828972-100828994 TATTATGACCAGAGGCTTGTAGG - Intergenic
1112886191 13:104175109-104175131 TGTTGTGGCCAGAGGCTTGCAGG + Intergenic
1113336435 13:109380899-109380921 TATTGTGACCAGAGTCTTGAAGG + Intergenic
1113463902 13:110500695-110500717 TCTTGTGAGCAGAGGCTTGCAGG - Intronic
1114227778 14:20754507-20754529 TATTGTGATCACATTCTGGCTGG + Intergenic
1114429035 14:22644741-22644763 TATTTTTTTCAGAGACTGGCAGG + Intergenic
1115163094 14:30417693-30417715 TATTGTGTTCAGAGGAGGCCAGG - Intergenic
1116971434 14:51070358-51070380 TTTTGTGACCAGAGGCTCACAGG + Intronic
1118522469 14:66600472-66600494 TGTTGTGACCAGAGGCTTACAGG - Intronic
1118786341 14:69048635-69048657 CCTTGTGATCAGTAGCTGGCTGG - Intergenic
1119110220 14:71965595-71965617 TTTTGGGAAGAGAGGCTGGCTGG + Intronic
1121017757 14:90558708-90558730 CAGTGTGAACAGAGGCCGGCAGG - Intronic
1121255878 14:92529980-92530002 TGTTGTGACCAGACGCTTGCAGG + Intronic
1122941685 14:104984366-104984388 GATGGTGATCAGGAGCTGGCTGG - Intergenic
1123026654 14:105427578-105427600 TGTTGTGACCAGAGGCTCGTAGG + Intronic
1127145354 15:56017621-56017643 TATTGTGACCGGAGGCTCCCTGG - Intergenic
1127337809 15:58007189-58007211 TGTTGTGATCAGAAGCTCACAGG + Intronic
1127564128 15:60169811-60169833 TATTGCGATGAGAGACTGTCTGG + Intergenic
1127809632 15:62552811-62552833 TTTTGTGATCAGAGGCTTGTAGG + Intronic
1128444670 15:67747775-67747797 GATTGTGAGCAGACACTGGCAGG + Intronic
1128554084 15:68618503-68618525 CAGTGTGATCAAAGGCTGGGAGG + Intronic
1129125171 15:73433950-73433972 TGTTGTGACCAGAGGCTCACGGG - Intergenic
1131050569 15:89344956-89344978 TGTTGTGAGCAGAGGCTCACAGG - Intergenic
1131192515 15:90328296-90328318 TATTGTGACCAGAGGCTTACAGG - Intergenic
1131381967 15:91971758-91971780 TGTTGTGAACAGAGGCTCGCAGG + Intronic
1131638495 15:94263374-94263396 TATTGTGGCCAGAGGCTGAAAGG - Intronic
1131988653 15:98070046-98070068 TATTGTGACCAGAGGCTCACAGG - Intergenic
1132215487 15:100058723-100058745 TCCGGTGATCAGAGGATGGCAGG - Intronic
1132333480 15:101028202-101028224 TGTGGTGACCAGAGGCTCGCAGG - Intronic
1134363885 16:13558470-13558492 TGTTGTGGTCAGAGGCTTGCAGG - Intergenic
1134463691 16:14452802-14452824 TATTTTTATTAGAGGATGGCAGG - Intronic
1134788849 16:16970068-16970090 TATTCTTATAAGAGGATGGCAGG + Intergenic
1135300685 16:21324258-21324280 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1135527470 16:23225037-23225059 AAGTGTGTTCTGAGGCTGGCAGG - Intergenic
1136420695 16:30130816-30130838 TGTGGTGATCAGAGGCTGGCAGG + Intergenic
1136544517 16:30947980-30948002 TATTGTGCGGAGAGGCGGGCAGG - Exonic
1137723839 16:50643690-50643712 TGTTGTGACCAGAAGCTGGCAGG - Intergenic
1138066157 16:53943410-53943432 GACTGTGATCAGTTGCTGGCTGG + Intronic
1138078359 16:54065014-54065036 CATTGTGACCAGAGTCAGGCGGG - Intronic
1138507216 16:57484394-57484416 GATTGTTGTCAGAGGCCGGCTGG + Intronic
1138631501 16:58298123-58298145 TGTTGTGACCAGAGGCTTTCAGG - Intronic
1138704107 16:58896480-58896502 TTTTGTGAACAGTGTCTGGCAGG - Intergenic
1140244983 16:73239929-73239951 CATTGTGACCAGAGGCTTGCAGG - Intergenic
1140957769 16:79881674-79881696 AAATGTGATCAGAGGCTTGCAGG + Intergenic
1142141538 16:88474852-88474874 TGCTGTGAACAGAGGCTGGGAGG - Intronic
1142466027 17:137890-137912 TATTATGACCAGAGGCTTGAAGG - Intronic
1142791991 17:2273849-2273871 TGTTGTGATCAGAGGCTTGAAGG + Intronic
1142803494 17:2359623-2359645 GGCTGTGCTCAGAGGCTGGCCGG + Intronic
1145118048 17:20230167-20230189 TGTTGTGACCAGAGGCTTGCAGG + Intronic
1145289513 17:21532186-21532208 TATTGCAACCAGAGGCTTGCAGG + Exonic
1146026014 17:29321624-29321646 TATTGTGATCAGAGGCTCGAAGG - Intergenic
1146269561 17:31476043-31476065 TGTTGTGATCAGAGGCTCACAGG + Intronic
1146296941 17:31657774-31657796 TGTTGTGACCAGAGGCTTGTGGG + Intergenic
1146311984 17:31776396-31776418 TAGTGTGATCAGAGGATGGAAGG - Intergenic
1148222414 17:45872367-45872389 TGATGTTATCAGAGGCCGGCAGG - Intergenic
1148398607 17:47332579-47332601 GATGGTTATCAGAGGCTGGGGGG - Intronic
1149426496 17:56559553-56559575 TCTTGTGACCAGAGGCTTGCAGG - Intergenic
1150474354 17:65463381-65463403 CAGTGTGCTCAGAGGCTGGCTGG - Intergenic
1152974372 18:199818-199840 TGTTGTGATCAAAGGCTGGCGGG + Intronic
1153138760 18:1947784-1947806 TGTTGTGACCAGAAGCTTGCAGG - Intergenic
1156871085 18:41945761-41945783 TGTTGTGACCAGAGGCTTGCAGG - Intergenic
1157126388 18:44960265-44960287 TATTGTGGTCAGGGGCTAGAGGG + Intronic
1157572117 18:48720016-48720038 TGTTGTGACCAGAGGCTTGCAGG + Intronic
1157802401 18:50631452-50631474 TGTTGCCATCAGAGGCTGGCAGG + Intronic
1158057605 18:53300633-53300655 TATTGTAACCAGAGGCTTGAAGG + Intronic
1158068911 18:53447111-53447133 CAGTGTGATCAGAGGCTCACAGG + Intronic
1158639617 18:59192481-59192503 AGTTGTAATCAGATGCTGGCTGG - Intergenic
1160625168 18:80199189-80199211 TGTTGTGACCAGAGGCTAACAGG - Intronic
1167701839 19:51053040-51053062 GATTGTGACCAGAGGCTCGAAGG + Intergenic
927515531 2:23669705-23669727 CACTGTGCTCAGAGGCTGACTGG - Intronic
928948823 2:36796343-36796365 TGTTGTGACCAGAGGCTCACAGG + Intronic
928997754 2:37312817-37312839 AAATGTGACCAGAGGCTTGCAGG + Intronic
930188567 2:48434681-48434703 TGTTGTGACCAGAGGCTCACAGG - Intergenic
930358641 2:50350105-50350127 AAATGTGATCAGAGGTTTGCAGG - Intronic
931171080 2:59804395-59804417 AATTGTAAGCAGAGGCTGCCTGG - Intergenic
931598898 2:63982493-63982515 TATTGTGACCAAAGGCTCGCAGG - Intronic
931627999 2:64274158-64274180 CCCAGTGATCAGAGGCTGGCTGG + Intergenic
932477521 2:72015892-72015914 CATTGTGATCAGAGGCTCATAGG - Intergenic
934702621 2:96454248-96454270 AAATGTGACCAGAGGCTTGCAGG - Intergenic
935821707 2:106899609-106899631 TGTTGTGGTCAGAAGCTTGCAGG - Intergenic
936140150 2:109932466-109932488 TACTGTGACCAGAGACTTGCAGG + Intergenic
936171048 2:110175070-110175092 CATTGTGACCAGAGGCTCACAGG + Intronic
936176839 2:110230411-110230433 TACTGTGACCAGAGACTTGCAGG + Intergenic
936204546 2:110439020-110439042 TACTGTGACCAGAGACTTGCAGG - Intronic
936440252 2:112545443-112545465 AAATGTGACCAGAGGCTCGCAGG + Intronic
936754235 2:115686428-115686450 TGTTGTGACCAGAGGCTCACAGG + Intronic
937424662 2:121788868-121788890 TCTTGTGAGCAGAGGCTTGCAGG + Intergenic
938735173 2:134179432-134179454 TGTTGTGACCAGGGGCTCGCGGG + Intronic
939165085 2:138631929-138631951 AATTGTGACCAGAGGCTCACAGG - Intergenic
940503205 2:154520561-154520583 AATGGTTATCAGAGGCTGGGAGG - Intergenic
942449189 2:176098646-176098668 TCTTGGGATCAGAGGCAGGAGGG + Intergenic
943040922 2:182803952-182803974 AAATGTGACCAGAGGCTTGCAGG - Intergenic
943700415 2:190983188-190983210 TGTTGTGACCAGAGGCTTGAAGG + Intronic
945141201 2:206688152-206688174 TATTGTGGCCAGAGGCTTGCAGG - Intronic
945371821 2:209027969-209027991 TATTGTGACCAGAGGCTTATAGG - Intergenic
945636613 2:212361231-212361253 TATTCTGATCTGAGGCTTTCAGG + Intronic
946319933 2:218947047-218947069 GATTGAGATGAGAGACTGGCAGG + Intergenic
1169516646 20:6323255-6323277 TATTGTGACCAGAGTCTGACAGG - Intergenic
1169579762 20:7006995-7007017 GGTTGTTAGCAGAGGCTGGCAGG + Intergenic
1170113757 20:12834470-12834492 CATTGTGATCAGAGGCTCTGGGG + Intergenic
1170234868 20:14091308-14091330 TATGGTTACCAGAGGCTGGAGGG + Intronic
1170721881 20:18888566-18888588 TCTTGTGATCAAGGGCTGGCAGG + Intergenic
1170746290 20:19102061-19102083 TGTTGGGATCAGAGGCTTGCAGG - Intergenic
1171106107 20:22434383-22434405 TGTTGTGACCAGAGGCTTGCAGG + Intergenic
1172497774 20:35401110-35401132 TGTTGTGACCAGAGGCTTCCAGG - Intronic
1172880443 20:38196236-38196258 TATGGAGCTTAGAGGCTGGCTGG + Intergenic
1173393701 20:42658162-42658184 CATTGTGAGCAGAGGCTCACAGG - Intronic
1174227147 20:49010337-49010359 CATCATGATCAGAGGCTGCCTGG - Exonic
1175501218 20:59452596-59452618 TGTTGTTTTCAGAGGCTGGCAGG - Intergenic
1179057582 21:37950337-37950359 TATTGTGACCAGAGGCTCGCAGG - Intergenic
1179213183 21:39343740-39343762 TGTTGTGATCAGAGGTTTGTAGG + Intronic
1180234687 21:46450829-46450851 TATTGGGATCAGAGTCTTGGGGG - Intergenic
1181730459 22:24842599-24842621 CATGGGGATCAGAGCCTGGCAGG + Intronic
1182743447 22:32586297-32586319 TATTGTGACCAGAGGCTTAAAGG - Intronic
1182974012 22:34605485-34605507 TAATGTGGTCAGAAGCAGGCAGG - Intergenic
1183058598 22:35321812-35321834 TGATGTGATCAGAACCTGGCTGG + Intronic
1184367393 22:44060881-44060903 TGTTGTGACCAGAGGCTCGCAGG - Intronic
1184692691 22:46124347-46124369 TGGTGTGAGCAGAAGCTGGCAGG - Intergenic
949259981 3:2094804-2094826 TCTTGTTACCAGAGGCTGTCAGG + Intergenic
950769007 3:15296036-15296058 TGTTGTGACCAGAGGCTCTCAGG + Intronic
951375722 3:21913785-21913807 TATTGTGATCAAAGGGTGGGAGG - Intronic
952056711 3:29455493-29455515 AGTTGTGATCAGAGGCTTGTGGG - Intronic
953822030 3:46215057-46215079 CATTGTGGTTTGAGGCTGGCAGG + Intronic
954423966 3:50433751-50433773 TATAGTGGTCTGAGGCTGACAGG + Intronic
955614173 3:60788307-60788329 TATTGTAATCAGAGGCTCTCAGG + Intronic
956385758 3:68717324-68717346 TATTCTGACCAGAGCCTGGTAGG + Intergenic
956628830 3:71294090-71294112 TGTTGTTATCAGGGGATGGCGGG + Intronic
959417041 3:106088006-106088028 TGTTGTGACCAGAGGCTCTCAGG + Intergenic
959927731 3:111942934-111942956 TATTGTGACTAGAGGCTTGCAGG + Intronic
960366196 3:116775830-116775852 TGTTGTGACCAGAGGCTTCCGGG + Intronic
960379087 3:116938270-116938292 TTTTGTGATTAGAGGGTGGAGGG - Intronic
960505139 3:118484021-118484043 TATTGTGACCAGAGGCTCCTAGG + Intergenic
961732653 3:128977916-128977938 TATTGGCAGCAGAGGCGGGCGGG - Intronic
961795562 3:129406366-129406388 GAATGTGGTCAGAGGCTGTCAGG - Intronic
962092968 3:132264415-132264437 TGTTGTGACCAAAGGCTTGCAGG - Intronic
962700768 3:137998250-137998272 TGTTGTGACCAGAGGCTTGCAGG + Intergenic
963726680 3:148930564-148930586 TTTTGTGATCATAGGATGTCAGG - Intergenic
963834451 3:150042484-150042506 TATTGTGACCAGAGGCTCACAGG - Intronic
964205441 3:154169838-154169860 TATTGTGACCAGAGGCTTGTAGG + Intronic
965136456 3:164777529-164777551 TGTTGTGACCAGAGGCTCACAGG - Intergenic
965707860 3:171527372-171527394 TGTTGGGATCAGAGGCTTGCAGG + Intergenic
969215404 4:5718228-5718250 TGTTGTGACCAGAGGCTTGTAGG - Intronic
971152374 4:24046973-24046995 TGTTGTGTTAAGATGCTGGCCGG + Intergenic
971235768 4:24840891-24840913 TGTTGTGACCAGAGGCTTCCAGG + Intronic
971427186 4:26527871-26527893 TGTTGTGACCAGAGGCCTGCAGG + Intergenic
971427262 4:26528802-26528824 TGTTGTGACCAGAGGCCTGCAGG - Intergenic
972276389 4:37561762-37561784 TATTGTGACCAGAGGCTTCTAGG - Intronic
972639743 4:40914652-40914674 TGTTGTGACCAGAGGCTTGCAGG + Intronic
972917783 4:43902785-43902807 TGTTGTGAACAGAGGCTCACAGG - Intergenic
973057520 4:45679178-45679200 TATTGATATTAGAGGGTGGCAGG - Intergenic
974460565 4:62182020-62182042 TATTGTGACCAGAGGTTCACAGG - Intergenic
975564567 4:75740238-75740260 AAATGTGATCAGAGGCTTGCGGG + Intronic
975808236 4:78135933-78135955 TGTTGAGATCAGAGGCTCACAGG - Intronic
976007760 4:80450990-80451012 GAATGTGATCATAGGCTGGATGG - Intronic
976050520 4:81007232-81007254 TATTGTGGCCAGAGGCTCCCAGG - Intergenic
978389486 4:108210081-108210103 TGTTGTGACCAGAGGCTTGAAGG + Intergenic
978751752 4:112256891-112256913 TATTGTGATCAGAGGCTTGCAGG - Intronic
983863949 4:172740964-172740986 AAGTGTGACCAGAGGCTTGCAGG + Intronic
984021794 4:174494302-174494324 TTTTGTGACCAGAGGCTTTCAGG + Intronic
984627277 4:182021363-182021385 TGATGTGATCAGAAACTGGCAGG - Intergenic
984883841 4:184432643-184432665 TATTGTGACCAGTAGCTCGCAGG + Intronic
985164935 4:187082969-187082991 CCCTGTGATCACAGGCTGGCAGG + Intergenic
986599120 5:9453670-9453692 TATGGTGACCAGAGGCTCGCAGG + Intronic
986840704 5:11693864-11693886 CATTGTGACCAAAGGCTTGCAGG - Intronic
987004716 5:13698447-13698469 TGTTGTGACCGGAGGCTTGCAGG - Intronic
987204549 5:15611577-15611599 AATTGTGAGCAGAGGCTCTCAGG + Intronic
987381022 5:17286211-17286233 AATGGTGATCAGAGACTAGCCGG + Intergenic
990441571 5:55851165-55851187 TGTTGTGACCAGAGGCTCACAGG - Intergenic
990488567 5:56282394-56282416 TGTTGTGACCAGAGGCTGGAAGG + Intergenic
993464800 5:88231811-88231833 TGTTATGACCAGAGGCTCGCAGG - Intronic
994833168 5:104811615-104811637 TGTTGTGACCAGAGGCTCTCAGG - Intergenic
995407731 5:111819630-111819652 TGTTATGACCAGAGGCTTGCAGG - Intronic
998371236 5:141662991-141663013 TATTGTAACCAGAGGCTAGCAGG + Intronic
999725297 5:154431761-154431783 TGTTGTGATCAGAGGCTTGCAGG - Intergenic
1000020383 5:157313197-157313219 TGTTGTGACCAGAGGCTCACAGG - Intronic
1000137599 5:158367868-158367890 TATTGTCCTCTGAGGCTGGGTGG + Intergenic
1000340445 5:160273207-160273229 TGTTGTGATCAGAGCCTTGCAGG - Intronic
1001187905 5:169594444-169594466 TATTGGGATCCAAGGCTTGCTGG - Exonic
1001350436 5:170957903-170957925 TGTTGTCACCAGAGGCTTGCAGG + Intronic
1001449211 5:171811117-171811139 TATTGTGACCAGAGGCTTGCAGG - Intergenic
1001454265 5:171848648-171848670 CACTGTGGTCAGAGGCTGGCGGG + Intergenic
1001549163 5:172589824-172589846 TGTTGTGACCAGAGGCTGAAAGG + Intergenic
1002177113 5:177407204-177407226 TGTTGTGACCAGAGGCTCACAGG + Intronic
1002923565 6:1591371-1591393 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1003354721 6:5356710-5356732 AAATGTGACCAGAGGCTCGCAGG + Intronic
1004403023 6:15306288-15306310 TAATGAGAAAAGAGGCTGGCTGG - Intronic
1007836993 6:44681652-44681674 TACTATGTGCAGAGGCTGGCGGG - Intergenic
1008077933 6:47165426-47165448 CGTTGTGATCATAGGCTTGCGGG - Intergenic
1009059653 6:58383263-58383285 TGTTGTGACCAGAGGCTTTCAGG + Intergenic
1009231255 6:61064139-61064161 TGTTGTGACCAGAGGCTTTCAGG - Intergenic
1010616567 6:78020289-78020311 TTTTGAAGTCAGAGGCTGGCAGG + Intergenic
1011854461 6:91671594-91671616 AATTGCGACCAGAGGCTGCCAGG - Intergenic
1011917156 6:92521393-92521415 TATTGTTAGCAAAGGCTGGGAGG + Intergenic
1012301834 6:97599362-97599384 AATTTTGGTCAGAGCCTGGCTGG + Intergenic
1014245831 6:119067656-119067678 TGTTGTGACCAGAGGGTGTCAGG + Intronic
1015438541 6:133219762-133219784 TATTGTGACCAGAGACTTGTAGG + Intergenic
1015595474 6:134862078-134862100 CATTGTGACCAGAGACTTGCAGG - Intergenic
1015934819 6:138398308-138398330 TACTGTGACCAGAGGCTTACGGG + Intergenic
1016158723 6:140848470-140848492 TATTGTAACCAGAGGCTTGAGGG - Intergenic
1017682212 6:156875594-156875616 TTTTGTGAGGAGAAGCTGGCAGG - Intronic
1017722624 6:157254506-157254528 AAATGTGACCAGAGGCTTGCAGG - Intergenic
1019809521 7:3154615-3154637 TTTTGTGGTCAGAAGTTGGCTGG + Intronic
1020028719 7:4918123-4918145 TCCTGTAGTCAGAGGCTGGCTGG - Intronic
1020605573 7:10332784-10332806 GATTGTAATCAGGGGATGGCTGG - Intergenic
1020711385 7:11609664-11609686 TATTGTGACCACAGGCAGGGAGG + Intronic
1021744749 7:23727854-23727876 TATTAAGATCTGAGGCAGGCTGG - Intronic
1022180703 7:27916422-27916444 TGTTGTGGCCAGAGGCTTGCAGG - Intronic
1022285242 7:28950452-28950474 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1024029976 7:45452085-45452107 TGTTGTGATCAGAGGCTCTCAGG + Intergenic
1024675037 7:51630706-51630728 TGTTGAGAGCAGAGGCTGCCGGG - Intergenic
1024689339 7:51782198-51782220 GATGGTGACCAGAGGCTGGGAGG + Intergenic
1024954863 7:54906786-54906808 TGTTGTGAACAGAGACTGGCAGG - Intergenic
1026286777 7:68970140-68970162 AAATGTGATCAGAGGCTTGCAGG - Intergenic
1026426080 7:70295285-70295307 TATTCTGATCAGAGTCAGCCTGG + Intronic
1028236433 7:88368203-88368225 TGTTGTGACTAGAGGCTTGCAGG + Intergenic
1028788629 7:94826907-94826929 TGTTGTGACCAGATGCTAGCAGG - Intergenic
1028802071 7:94977701-94977723 TATGGTGATAAGAGGCTAGGTGG + Intronic
1028809167 7:95064181-95064203 AAATGTGACCAGAGGCTGGCAGG - Intronic
1029141431 7:98413461-98413483 TATAGTGATCAGATACTGACGGG - Intergenic
1031971934 7:128071304-128071326 TATTGTGACCAGAGGCTCACAGG + Intronic
1032381203 7:131483432-131483454 TGTTGTGACCAGAGGCTTGTAGG - Intronic
1032943488 7:136823247-136823269 GATTGTCCTCAGTGGCTGGCTGG - Intergenic
1033074812 7:138238884-138238906 TGTTGTGAACAGAGGCTTTCAGG + Intergenic
1033944931 7:146705229-146705251 TTTTGTGATCACAGCCTGGAAGG - Intronic
1033991253 7:147290107-147290129 TATTGTGATCAGAGGCTGGCAGG - Intronic
1034057138 7:148047268-148047290 TACTGTGACCAGAGGCTTGCAGG - Intronic
1036390682 8:8321902-8321924 TATTGTGACCAGAGGTTCCCAGG - Intronic
1037255922 8:16953525-16953547 GATGGTTATCAGAGGCTGGCTGG + Intergenic
1037415169 8:18641761-18641783 TACTGTGATCAGATGATTGCAGG + Intronic
1037560667 8:20071903-20071925 TACTGTAACCAGAGGCTTGCAGG + Intergenic
1037828652 8:22175535-22175557 TGTTGTGACCAGAGGCTTGAAGG - Intronic
1038976533 8:32703117-32703139 TATTGTGGTCAAAGGATGGGAGG + Intronic
1039392892 8:37196164-37196186 TATTGTGATCAGCAGCTGAGGGG + Intergenic
1039717160 8:40122240-40122262 TGTTGTGAGCAGAGGCTCGTGGG + Intergenic
1039818045 8:41112005-41112027 AAATGTGACCAGAGGCTTGCAGG - Intergenic
1039847541 8:41336405-41336427 CTTTGTCATGAGAGGCTGGCAGG - Intergenic
1041063320 8:54057644-54057666 TATGGTTATCAGAGGCTGGAAGG + Intronic
1041654762 8:60337487-60337509 AAATGTGACCAGAGGCTGGCAGG - Intergenic
1041799864 8:61787204-61787226 GATTGTGAGCAGTGGCTGGTTGG + Intergenic
1042914742 8:73864511-73864533 TAATGTGACCAGAGGCTGGCAGG - Intronic
1043098921 8:76014794-76014816 TGTTGTGACCAGAGGCTTGCAGG - Intergenic
1043818232 8:84829787-84829809 TGTTGTGATCAGAGGCTCATAGG - Intronic
1044876269 8:96669910-96669932 AAATGTGACCAGAGGCTTGCAGG - Intronic
1045008757 8:97938790-97938812 TATTGTCACCAGAGGATTGCAGG - Intronic
1045590811 8:103594499-103594521 AAATGTGATCAGAGGCTGTTAGG + Intronic
1045945050 8:107786041-107786063 TATTGTGACTAGAGGCTTGCAGG - Intergenic
1045972678 8:108097240-108097262 TGTTGTGATCAAAGGCTTGTAGG - Intergenic
1046025549 8:108718449-108718471 TGTTGTGAACAGAGGTTTGCAGG - Intronic
1047259887 8:123246178-123246200 TATTGTGACCAGAGGCTCCCAGG - Intronic
1050204558 9:3182908-3182930 TGTTGTGACCAGAAGCTTGCAGG + Intergenic
1051261418 9:15268951-15268973 GGATGTGGTCAGAGGCTGGCGGG - Intronic
1051446747 9:17148363-17148385 TGTTGTGACCAGAGGCTTACAGG - Intronic
1054852178 9:69858676-69858698 AAATGTGACCAGAGGCTTGCAGG + Intronic
1055472409 9:76626111-76626133 CATTGTGACCAGATGCTTGCAGG + Intronic
1055565354 9:77562951-77562973 TATTGGGATCTAATGCTGGCTGG - Intronic
1058546779 9:106069071-106069093 TAATGTAGTCAGAGGCTGGTCGG - Intergenic
1059788107 9:117608912-117608934 TGTTGTGACTAGAGGCTTGCAGG - Intergenic
1060556542 9:124510870-124510892 TAATGTATTCAGTGGCTGGCTGG + Intergenic
1061018999 9:128001849-128001871 GATGCTAATCAGAGGCTGGCTGG - Intergenic
1061405289 9:130390432-130390454 CTTTGTGTTGAGAGGCTGGCTGG + Intronic
1062104876 9:134749869-134749891 TATAGTGGTCTGAAGCTGGCTGG + Intronic
1186310723 X:8315454-8315476 TATCGTGACCAGAGGCTGGCGGG + Intergenic
1187030054 X:15477395-15477417 TATTGTGACCAGAGGCTTGCAGG - Intronic
1189140260 X:38597619-38597641 TGTTGTGACCAGAGGCTTGTAGG + Intronic
1189357289 X:40319976-40319998 TATTGTGACCAGAGGCTTGCAGG + Intergenic
1189365739 X:40387032-40387054 TAATGTGATCAGAGGCTTGTAGG - Intergenic
1190952609 X:55161443-55161465 AAGCGTGTTCAGAGGCTGGCTGG - Intronic
1192342487 X:70275971-70275993 TAATATGATCGAAGGCTGGCTGG - Intronic
1193925959 X:87485357-87485379 TATTATGACCAGAGGCTTGCTGG - Intergenic
1198614994 X:138447314-138447336 CATGGTTATCAGAGGCTGGTGGG - Intergenic
1200361951 X:155616480-155616502 TCTTGTGCTCAGAGATTGGCTGG + Intronic