ID: 1033991460

View in Genome Browser
Species Human (GRCh38)
Location 7:147292586-147292608
Sequence CTGATGATTTGGAGGAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033991456_1033991460 -8 Left 1033991456 7:147292571-147292593 CCTTAATTTCTCTCACTGATGAT 0: 1
1: 0
2: 0
3: 30
4: 247
Right 1033991460 7:147292586-147292608 CTGATGATTTGGAGGAATCAGGG 0: 1
1: 0
2: 2
3: 16
4: 212
1033991455_1033991460 6 Left 1033991455 7:147292557-147292579 CCATTTGTTTAGTGCCTTAATTT 0: 1
1: 0
2: 3
3: 77
4: 575
Right 1033991460 7:147292586-147292608 CTGATGATTTGGAGGAATCAGGG 0: 1
1: 0
2: 2
3: 16
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033991460 Original CRISPR CTGATGATTTGGAGGAATCA GGG Intronic
900545166 1:3224681-3224703 ATGATGAGGTGGAGGAATGAGGG + Intronic
902685438 1:18073822-18073844 CTGATGTTTTGGCTGACTCAGGG - Intergenic
903668788 1:25023313-25023335 CTGAGGTTTTGGAGGAATCAGGG - Intergenic
904040558 1:27582037-27582059 CTGCTGGTCTGGCGGAATCAGGG - Intronic
906841899 1:49148092-49148114 TTGATGATATGAAGAAATCAAGG - Intronic
907371961 1:54009603-54009625 CTGGGGACCTGGAGGAATCAAGG - Intronic
911085778 1:93976443-93976465 CTCTTGCTTTGGAGGAAGCATGG + Intergenic
911818191 1:102381987-102382009 CTGAAGCTATGTAGGAATCAAGG + Intergenic
912071714 1:105818778-105818800 CTGATCATGTTGAGGAATTAGGG - Intergenic
912147780 1:106815446-106815468 ATGATGGTTTGGATGATTCAAGG - Intergenic
912661312 1:111533279-111533301 CAGATTATTTCCAGGAATCAAGG - Intronic
913024520 1:114823714-114823736 CTGTTAATTTGTAGTAATCATGG - Intergenic
915553039 1:156646299-156646321 CTGGTGGGTTGGAGAAATCATGG + Intronic
918843687 1:189580895-189580917 CTGCTGACTTGGAGGATTCTAGG + Intergenic
920849261 1:209617648-209617670 CTGATGAGTTGGAGAAAAAATGG - Intronic
921800586 1:219398601-219398623 GTGGTCATTTGGAGGAATGAAGG + Intergenic
922326250 1:224531085-224531107 ATGTTGATTTGGAGACATCAAGG + Intronic
923375028 1:233353106-233353128 ATGATGCTTTGGAGAACTCAGGG + Intronic
1064272258 10:13876070-13876092 CTGATGATTTGCAGTGATAACGG - Intronic
1064433088 10:15287928-15287950 CAGTGGATTTGGAGGACTCAGGG - Intronic
1069716675 10:70525702-70525724 CCGATGCTTTGGGGGAGTCACGG - Intronic
1073535547 10:104273836-104273858 CTGAGCAATTGTAGGAATCAAGG + Intronic
1074209838 10:111320491-111320513 CTGAGGATATGTAGGAATCTAGG + Intergenic
1074235540 10:111581210-111581232 CTGATGAGTTGAAGTCATCAAGG + Intergenic
1074649163 10:115499840-115499862 TTAGTGATTTGGAGGCATCAAGG + Intronic
1076189456 10:128472691-128472713 CTGATGCCATGGAGGAGTCAGGG - Intergenic
1077929226 11:6712858-6712880 CTGATGATCTAAAGGAATCCTGG - Intergenic
1077979292 11:7283751-7283773 CTGTTAATTTGTAGTAATCATGG + Intronic
1078911523 11:15737044-15737066 CTGATGTTTATGAGGAATCAAGG - Intergenic
1079888692 11:26022630-26022652 TTGATGATTTGGTACAATCATGG - Intergenic
1080469280 11:32529506-32529528 TTGATGATTTGGAGGAGCCAGGG - Intergenic
1081177593 11:39947533-39947555 GTGATCATTTGGAGGAAAGAGGG - Intergenic
1084011054 11:66348544-66348566 CGTATGATCTGCAGGAATCAGGG + Intronic
1084053313 11:66615334-66615356 ATGAGGACTTGGAGTAATCAAGG - Intergenic
1085009472 11:73128067-73128089 CTGATAATTTGGAGAAATGGTGG - Intronic
1085130371 11:74033096-74033118 CAGATGAATTGGATAAATCAGGG + Intronic
1085759016 11:79225798-79225820 ATGATGGTTTGGAGGGATGATGG + Intronic
1085853644 11:80151049-80151071 CTGATTTCTTGGAGGAATGATGG - Intergenic
1086071484 11:82804318-82804340 TTGATGATATTGAGGAATTATGG + Intergenic
1086269634 11:85046067-85046089 CTAATAATATGGAGGAAGCAGGG - Intronic
1088069887 11:105769382-105769404 CAGATGATGTGGAGGAAAAAGGG + Intronic
1088364286 11:109022526-109022548 AGGAAGATTTGGAGGAACCAAGG + Intergenic
1089417125 11:118301581-118301603 CTGATGATAAGGAGGAGGCAGGG + Intergenic
1089518096 11:119046397-119046419 CTGGTGAGTTGGAGCAACCATGG - Exonic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1092091920 12:5810726-5810748 CTGGTGATTTGAAGGAGACATGG - Intronic
1092318611 12:7446837-7446859 CTGAAGATTTGGAAAAATCTCGG + Intronic
1092589390 12:9936709-9936731 CTGGTGACTTGAAGAAATCATGG - Intergenic
1092798524 12:12139242-12139264 CTGATATTTTGGAAGTATCAAGG + Intronic
1093063392 12:14630939-14630961 CTGATTGTGTGGAGGAATCCTGG + Intronic
1095190457 12:39251791-39251813 CTGTTGATTTGGAGGTATGAGGG - Intergenic
1097903773 12:64899503-64899525 ATGCTGATTTGTAGGTATCAGGG - Intergenic
1098281528 12:68867474-68867496 ATGCTAATTTGGGGGAATCATGG + Intronic
1098861400 12:75714902-75714924 CCAATCATTTGAAGGAATCACGG + Intergenic
1099499505 12:83395825-83395847 CTAATAATATGGAGTAATCACGG - Intergenic
1100379969 12:94052397-94052419 CTGATGATTGGTATTAATCATGG + Intergenic
1101788989 12:107911318-107911340 CTGATGATGAGGAGGGAGCAGGG + Intergenic
1101941757 12:109104514-109104536 CTGATGGGATGGAGGATTCAAGG - Intronic
1103838467 12:123843461-123843483 CTCCTGATGTGTAGGAATCATGG + Intronic
1104247203 12:127055319-127055341 CAGTTGATTTAAAGGAATCATGG - Intergenic
1104378614 12:128287387-128287409 ATGTTAATTTGGAGGAATCTAGG - Intronic
1105216224 13:18287573-18287595 TTGATGATGTGGAGGAGTTATGG - Intergenic
1105938744 13:25128232-25128254 CTGGTGACATGGAGGATTCAAGG - Intergenic
1106780990 13:33058727-33058749 CTGTTGTTTTGGAACAATCACGG + Intronic
1107510209 13:41076129-41076151 CTGATGATTTGGATTCATCTAGG - Exonic
1107991000 13:45819193-45819215 CTGATGATTTGGTGACAGCAGGG - Intronic
1109278350 13:60326713-60326735 CTGAAGGATTGGACGAATCAAGG + Intergenic
1109307881 13:60661322-60661344 CTGCTAGTTTGGAGGAATCCCGG - Intergenic
1109348313 13:61144715-61144737 CTGATTATCTGTAGGAATAAAGG + Intergenic
1109482343 13:62973150-62973172 CATAAGATTTGGAGGAGTCAGGG - Intergenic
1109973793 13:69804792-69804814 CTAATGATTTGATGGCATCAAGG - Intronic
1109989603 13:70037420-70037442 CTGAACATTTGGTTGAATCAGGG + Intronic
1111807954 13:93061614-93061636 CTGATGATTTTGAGGGAGAAGGG + Intergenic
1114382622 14:22224063-22224085 CTGATGTTTCAGAGGAATGATGG + Intergenic
1115257054 14:31414561-31414583 CTGATGTGCTGGAGGAATAATGG - Intronic
1118440437 14:65806807-65806829 CTGATGACTTGGGTGAATCAGGG + Intergenic
1119251348 14:73157629-73157651 CTGGGGATGGGGAGGAATCAGGG - Intronic
1119965125 14:78906465-78906487 CTGATTATTTCTAGGGATCAAGG - Intronic
1120179070 14:81324833-81324855 TTGTTGGTTTGGAGGAAGCATGG + Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1124005738 15:25794049-25794071 ATTCTGATTTAGAGGAATCAGGG - Intronic
1124821242 15:33047643-33047665 CTGATGATTTTGAGTTATCAAGG + Intronic
1125419335 15:39488406-39488428 CTGATGAGTTGGATGCATCTGGG - Intergenic
1125492678 15:40159963-40159985 CTGATGATTCAGAGGAAAGAAGG + Intergenic
1128780646 15:70356684-70356706 CTGATGATTTGGCAGAACCCTGG + Intergenic
1128847227 15:70910031-70910053 CTGATGATTTGGATGAAGTGAGG + Intronic
1128975389 15:72149230-72149252 TGGATCATTTGGAGGAATGAAGG + Intergenic
1129647912 15:77454892-77454914 CTGATGTTTTAAAGGAACCAAGG + Intronic
1130133768 15:81164689-81164711 CTCATGATTTGGCAGGATCAGGG - Intronic
1137533722 16:49301062-49301084 CAGATGCTTTGAAAGAATCAGGG - Intergenic
1138245334 16:55463020-55463042 CTGATGCAGTGGAGGAATGAAGG - Intronic
1138870018 16:60871262-60871284 ATGATCAATTGGAGGAATCTTGG + Intergenic
1139251195 16:65498158-65498180 CTGAGGAGTTGGAGGAACCCTGG + Intergenic
1143718942 17:8796938-8796960 CAGCTGACTTGGATGAATCATGG - Intergenic
1144543147 17:16165757-16165779 CTGCTGATTTGGAGGCACAATGG - Intronic
1144600579 17:16609063-16609085 CTGATGATTAGAAGGAAGTAGGG - Intergenic
1147865211 17:43547274-43547296 CTGATGATCTGGAGGCAGGATGG + Intronic
1149794354 17:59505718-59505740 CTGAAGATTCAGAGGAATCCAGG + Intergenic
1153349469 18:4062631-4062653 CTGATTATTTGCATGAAGCACGG - Intronic
1153591785 18:6682204-6682226 CTGATGATTTTGTGTAAACAGGG - Intergenic
1153894319 18:9544685-9544707 CTGGAGATTGGGAGAAATCAGGG + Intergenic
1156699946 18:39814300-39814322 GTGATCATTTGGAGGAAAGAGGG + Intergenic
1159056660 18:63472439-63472461 TTGATGATTTGTAGGAATCCGGG + Intergenic
1160671857 19:368932-368954 CAGTTGGTTTGGATGAATCAGGG - Intronic
928215372 2:29356929-29356951 CTGAAGATGTGGAGCAGTCATGG - Intronic
928913418 2:36446010-36446032 CTGATTATGTGGAGAAATCAGGG + Intronic
929280391 2:40072008-40072030 GTGGTGATTTGGAGGAAAGAGGG + Intergenic
929946291 2:46375099-46375121 CAGATGACCTGGAGAAATCAAGG + Intronic
930673129 2:54172423-54172445 TTGATGATTTGGAGAAAAGAAGG - Intronic
931685242 2:64786860-64786882 CTGGTGTTTTGGGGGAATGAGGG + Intergenic
933031775 2:77337251-77337273 CTCATTGTTTGGAAGAATCAAGG + Intronic
933426641 2:82121701-82121723 CTGATACTTTGGATAAATCAAGG - Intergenic
933570430 2:84004460-84004482 CTAATGATTTGCAGCAATCCAGG + Intergenic
934075267 2:88423001-88423023 CTGATGATTTAGAAGAAGGACGG + Intergenic
934298102 2:91759152-91759174 TTGATGATGTGGAGGAGTTATGG + Intergenic
935170323 2:100606511-100606533 CTGCAGAGGTGGAGGAATCACGG + Intergenic
937939281 2:127272667-127272689 CTGAGGATTTGCATGCATCATGG - Intronic
939758220 2:146139641-146139663 ATGATGATTTGGAGAAATCCAGG + Intergenic
940176118 2:150879253-150879275 GTGGTGATTTGGAAAAATCAAGG - Intergenic
940410038 2:153351007-153351029 CTGATGATTTGTAGGTTTTAAGG + Intergenic
941234925 2:162959721-162959743 CTGATGACTAGCAGGCATCATGG + Intergenic
941588120 2:167384931-167384953 CTGATGATTTGGAGGGAGATGGG - Intergenic
942077765 2:172372450-172372472 CACATAATTTGGAGGAATGAAGG - Intergenic
942917957 2:181335258-181335280 CTGATGATTTCCGGGAAACATGG - Intergenic
943032061 2:182697401-182697423 GTGATAATTTGGAGGAGTGAGGG + Intergenic
943391805 2:187278968-187278990 CTGCTGAGTTGGAGGTGTCAAGG + Intergenic
944199862 2:197095061-197095083 CTGATTAGTTGGAGAAATAATGG - Intronic
945192547 2:207204777-207204799 GTGATTATTTGTAGGAAACATGG - Intergenic
1169562004 20:6811703-6811725 CTGAGGACTTTGAGGAATCAAGG - Intergenic
1171998360 20:31751227-31751249 ATCATGCTTTGGTGGAATCATGG + Intronic
1173009564 20:39169548-39169570 CTGAGGATGAGTAGGAATCAAGG - Intergenic
1173620827 20:44434623-44434645 CTGATGAGGTGGAGGATCCAAGG - Intergenic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1178033599 21:28555834-28555856 GTGATGATTTGGAGGAAAAGAGG - Intergenic
1180016808 21:45092137-45092159 GTGATGCTTTGGAGGAAGTATGG + Intronic
1182990098 22:34759400-34759422 CTGATGACTTGTTGGGATCATGG + Intergenic
951427752 3:22567714-22567736 CTGATGATTTGGGGCGATTATGG - Intergenic
952336586 3:32408677-32408699 CTGATGGTTTGGGGGAATCTGGG - Intronic
952734935 3:36680265-36680287 CTGAGATTTTGGAGGAGTCAGGG - Intergenic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
953477326 3:43216610-43216632 TTGATGATTTTGAGGAGTGATGG - Intergenic
953859887 3:46534773-46534795 CTGATGAAGGGGAGGAGTCAGGG - Intronic
954333877 3:49904923-49904945 CCCCTGATATGGAGGAATCATGG + Intronic
954385717 3:50242822-50242844 CTTATGGCTTGGAGGAATCTGGG + Intronic
958989342 3:100824315-100824337 CTGAGGATTTGGATGAATGGAGG - Intronic
959387720 3:105732988-105733010 TTGAGTATTTGGAGGAGTCATGG - Intronic
961617333 3:128193199-128193221 CTCAGGACTTGGGGGAATCAGGG + Intronic
963957276 3:151268766-151268788 CAGATGAAATGGAGGAATCAAGG + Intronic
965558462 3:170039751-170039773 CTGATTATTTGATGGTATCAAGG + Intronic
969276243 4:6137730-6137752 CTGATGAATTGAATGAATGATGG - Intronic
971311936 4:25532412-25532434 CTGCTGATTTGAAGCAATCAAGG + Intergenic
971804483 4:31337623-31337645 CTGATGATTCTGTGGAAACATGG + Intergenic
972249825 4:37287712-37287734 CTGATGGTTCTGAGGAATCTGGG + Intronic
972659713 4:41104363-41104385 CTGAGGATATACAGGAATCAAGG + Intronic
972801620 4:42481824-42481846 CTCATGATTTGGTGTGATCACGG - Intronic
973003781 4:44985491-44985513 CTGGAGTTTTGTAGGAATCATGG - Intergenic
973238253 4:47929472-47929494 CTGACGATTAGGAGAAAGCAAGG + Intronic
973608250 4:52608874-52608896 CTGAGCATTTGGAGGAGTAAGGG + Intronic
975391822 4:73827686-73827708 ATGATGATATGGAGTAGTCAGGG + Intergenic
975505955 4:75137795-75137817 CTGATGATTTGGAGACTTCTTGG - Intergenic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
977696632 4:99972682-99972704 GTGATCATTTGGAGGAAAGAAGG - Intergenic
978461602 4:108960530-108960552 CTGAGGATAGGGAAGAATCAAGG + Intronic
981449566 4:144880568-144880590 CTGAGGAATTTGAGGAGTCAAGG + Intergenic
981787093 4:148491767-148491789 CTGAGGAATTGGAAGAATGAAGG - Intergenic
982103380 4:151990441-151990463 CTGTTGGTTTTGATGAATCATGG - Intergenic
982819147 4:159924789-159924811 CTGATGATTTTGAGCAAAGAAGG + Intergenic
983854796 4:172630688-172630710 ATGTTGAGTTGGAGGAATAAAGG - Intronic
987093260 5:14525901-14525923 CTGCTGAGGTGGAAGAATCATGG + Intronic
988462141 5:31449393-31449415 ATGATGACTTGGATGAGTCATGG + Exonic
988466900 5:31500040-31500062 CAGATGATTTAGAGGAATCTGGG - Intronic
993053710 5:82955318-82955340 CTGAGGATCTGGGGGAATAAAGG + Intergenic
993377229 5:87162972-87162994 TTGATAATATGAAGGAATCATGG + Intergenic
993800228 5:92324294-92324316 CTGATGATCTGGAGAACACAAGG - Intergenic
993837612 5:92834898-92834920 CTGCTGGCTTTGAGGAATCAAGG - Intergenic
997294839 5:132762867-132762889 ATGGTGATTTGGGGGAACCAGGG - Intronic
998661970 5:144248715-144248737 CTGATGAATTGGATGTGTCACGG + Intronic
1000785342 5:165535996-165536018 ATGAGGATTAGGTGGAATCATGG + Intergenic
1004493667 6:16142767-16142789 GTGATGAATTGGAAGAATTATGG - Intronic
1009546810 6:65030648-65030670 CTGCTGTGTTGGAGGAATCAAGG - Intronic
1009690688 6:67028928-67028950 CTCAGCAATTGGAGGAATCATGG - Intergenic
1010253434 6:73731951-73731973 CTGATGATTTGGAGGCACTGTGG + Intronic
1016234987 6:141853919-141853941 CTGATCATCAGGAAGAATCAAGG - Intergenic
1017317454 6:153048285-153048307 CAGATGAAATAGAGGAATCAAGG - Intronic
1019474702 7:1238432-1238454 CTGATGACCAGGAGGGATCAGGG - Intergenic
1021351886 7:19603567-19603589 CTGATATTTTTGAAGAATCAAGG + Intergenic
1021595219 7:22308591-22308613 CTAATAATTGGGAGCAATCAGGG + Intronic
1021776626 7:24060506-24060528 GTGATCATTTGGAGGAGACAAGG - Intergenic
1022658850 7:32347306-32347328 TTGATTTTTTTGAGGAATCAAGG + Intergenic
1024145603 7:46513535-46513557 GTGAGGATGTGGAGGAATGAGGG - Intergenic
1026290560 7:69002162-69002184 TTGATGATTTGGGGGAATATGGG - Intergenic
1028250629 7:88535840-88535862 CTCATGAATTGTAGGAATAAAGG - Intergenic
1028587655 7:92467891-92467913 CTGATGCCTTCGAGGAACCAGGG + Intergenic
1029943022 7:104500277-104500299 CAGTTGATTAGAAGGAATCACGG - Intronic
1030613100 7:111710134-111710156 TTCATGAATTGGAAGAATCAAGG + Intergenic
1030887851 7:114960986-114961008 CTCAAGATTTGGAGGACCCAAGG + Intronic
1031299298 7:120043372-120043394 CATGTGATTTGGAGGGATCAGGG + Intergenic
1031946843 7:127851144-127851166 TTGCTGATTTGTAGGATTCAAGG - Intronic
1032872749 7:136003619-136003641 CTGCTGATTTAAAGAAATCAGGG + Intergenic
1033991460 7:147292586-147292608 CTGATGATTTGGAGGAATCAGGG + Intronic
1035936621 8:3848231-3848253 CTGAGGATTTGCAGGTATTAAGG - Intronic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1040864413 8:52033614-52033636 TTGATGAATTCCAGGAATCAAGG + Intergenic
1041055204 8:53978523-53978545 CTGATGATGTGGATGACTAATGG - Intronic
1048623107 8:136156481-136156503 TTGATGATAGGGAGGAATAATGG - Intergenic
1049043441 8:140129952-140129974 CTGTGGCTTCGGAGGAATCAGGG + Intronic
1050102050 9:2129510-2129532 CTGATGAGCTGGAGGACTGATGG - Intronic
1050604785 9:7289554-7289576 CTGCTGCTTTGGAGGAGTGAAGG + Intergenic
1051054032 9:12962362-12962384 CTGATGATTTTGAGGGATCCAGG - Intergenic
1054769255 9:69068798-69068820 CAGAGGGTTTGGAGCAATCAAGG - Intronic
1056901172 9:90600721-90600743 CTCATGATTTCGTGGAACCATGG + Intergenic
1057250823 9:93500259-93500281 CAGATGATGGGGAGGAAGCAAGG - Intronic
1057318667 9:93991366-93991388 AAGATGATTTGGAGGCATAAAGG + Intergenic
1059921140 9:119161207-119161229 CTGATGATGGGGAGAAATAAGGG - Intronic
1060011199 9:120044240-120044262 GTGAATATTTGGAGAAATCAAGG - Intergenic
1185868979 X:3647926-3647948 CTTATGATTTGGAAGAATCTAGG + Intronic
1186468729 X:9804721-9804743 CTGAAAATTGGGAGGAACCAGGG + Intronic
1187188042 X:17006439-17006461 CAGAAGAGTTGGAGGAAGCAAGG - Intronic
1187330216 X:18331595-18331617 TTGATGATTTTAAGGAATTATGG - Intronic
1189032689 X:37466447-37466469 ATGATTATTTGGGGGATTCAAGG - Intronic
1190454589 X:50615415-50615437 CCCATGCTTTGGGGGAATCAGGG - Intronic
1192003603 X:67185053-67185075 CTCATGCTTTGGGGGAAGCATGG - Intergenic
1192307407 X:69976673-69976695 GTAATGATTTGGAGAAAACAAGG + Intronic
1192404579 X:70871459-70871481 TTTATTATTTGGAGGAATTATGG - Intronic
1194125061 X:90007181-90007203 CTGATGGTGTGGAGGTCTCAGGG + Intergenic
1194344751 X:92750220-92750242 ATGATCATTTGGAGGAAAGAAGG + Intergenic
1194536258 X:95108532-95108554 CTGATGATGAGGAGGAAGGAGGG - Intergenic
1195071741 X:101287982-101288004 GTGATGATTTGAAGTAAACAAGG + Intronic
1198558838 X:137826095-137826117 ATGATGAACTGGAGGAAGCAGGG + Intergenic
1200653096 Y:5866860-5866882 ATGATCATTTGGAGGAAAGAAGG + Intergenic
1201683259 Y:16672265-16672287 CTGTTTCTTTGGAGGCATCATGG - Intergenic