ID: 1033992940

View in Genome Browser
Species Human (GRCh38)
Location 7:147310336-147310358
Sequence TGTCAATGGTAAATGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033992940 Original CRISPR TGTCAATGGTAAATGGCCGC AGG (reversed) Intronic
901067681 1:6502174-6502196 TGTCCTGGGTAAATGGCTGCTGG + Intronic
901232849 1:7650918-7650940 GGTCAATGGGAAATGGCAGCCGG - Intronic
902437032 1:16404952-16404974 TGTCAATGGTGAGTGGCAGAGGG - Exonic
903329612 1:22590575-22590597 GGTCAATGGAAAATGGGCGTGGG - Intronic
909341018 1:74531112-74531134 TTTCAATGGCAAATGTCCCCAGG - Intronic
912902073 1:113662132-113662154 TGTCAATGGGGAATGGCTGATGG - Intronic
917430594 1:174963936-174963958 TGTCAGTGATAAATGACAGCTGG - Intronic
921550644 1:216531638-216531660 TATCAGTGGTAAAAGGCTGCCGG + Intronic
921849605 1:219920884-219920906 TGTAAATGGCAAAGGGCCCCAGG + Intronic
922609401 1:226913340-226913362 TGTCTATGTTAAATGACTGCAGG - Intronic
1064171767 10:13039967-13039989 TGACATTGGTAAATGGTCTCTGG + Intronic
1070562643 10:77579289-77579311 TGTCAGTGACAAATGGCCACAGG + Intronic
1074436331 10:113437444-113437466 TGGTAATGGTAAATGGCACCTGG + Intergenic
1078054300 11:7994727-7994749 TGTGAATGGTATGTGGCCTCTGG - Intronic
1082688597 11:56271685-56271707 TGACAATGGTAACGGGCTGCTGG - Intergenic
1082776495 11:57249023-57249045 TGGCAAGGGTAGATTGCCGCTGG - Intergenic
1085108483 11:73866607-73866629 TGTCACTGGAAAAGGGCAGCAGG + Intergenic
1091281193 11:134382865-134382887 TGTCTATTGCAAATGGCCGGTGG + Exonic
1097927226 12:65142360-65142382 TGTAACTGGAAAATGGCAGCAGG + Intergenic
1099401305 12:82206100-82206122 TTTCCCTGGTAAATGGCCACGGG + Intergenic
1104799610 12:131544986-131545008 GGGGAATGGTAAATGGCCACTGG - Intergenic
1115963966 14:38865803-38865825 TGTAAATGGAAGATGGCTGCAGG + Intergenic
1122873409 14:104651636-104651658 TGTCAGTGAGAAGTGGCCGCAGG + Intergenic
1131380122 15:91956520-91956542 TGGCAATGGGAAATGGCCTCCGG + Intronic
1132086863 15:98915701-98915723 TGTAAATGGAAAAAGGCTGCGGG - Intronic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1133463594 16:6008438-6008460 TGTGAATGGGAAATGGCAGGGGG + Intergenic
1135760595 16:25134983-25135005 TGTCAGTGTTAACAGGCCGCTGG + Intronic
1140628054 16:76818511-76818533 TGTCAATGGAAAAGGGCCACAGG - Intergenic
1141808089 16:86355245-86355267 TTTCAATGGAAAATTGCCCCGGG - Intergenic
1143421299 17:6794826-6794848 AGTCAATGGCAAGTGGCCACTGG - Intronic
1144139980 17:12338899-12338921 TGACAATGGTAAGTGGCAGAAGG - Intergenic
1153527128 18:6008146-6008168 TCCCAATGGTAAGTGGCCACGGG + Intronic
1157729758 18:49993384-49993406 TGTCAATAATAGATGGCTGCCGG - Intronic
1162693633 19:12454034-12454056 TTTCAATGGTATCTGTCCGCTGG - Intronic
1163502420 19:17684502-17684524 TGTGAATGGTAAATGCCACCTGG - Intronic
1163804048 19:19385546-19385568 TGCCAATGGTAGATGGGAGCGGG - Intergenic
927396465 2:22656720-22656742 TCACAATGGTAAATGGGCACTGG - Intergenic
936731611 2:115387924-115387946 TGACAATGGTAAATGTGCACTGG + Intronic
937050098 2:118881645-118881667 TTTCTTTTGTAAATGGCCGCAGG + Intergenic
1173824354 20:46037870-46037892 TGTTAATGGTAGATGGCTGGTGG + Intronic
1173891765 20:46517967-46517989 TGTTTATGGTAAATGACTGCAGG + Intergenic
1181376981 22:22466618-22466640 TGCTAATTGTAAATGGCCCCTGG - Intergenic
953099770 3:39812503-39812525 TGACATTGGTCAATGGCGGCTGG + Intronic
953638631 3:44685212-44685234 TGGCAATGGTAAATTGACGTGGG - Intergenic
955142547 3:56283909-56283931 TTTCCTTGGTAAATGGCCACTGG + Intronic
956398398 3:68850033-68850055 ACTCAATGGTAAATGGCAACTGG - Intronic
957075245 3:75597434-75597456 TGTAAATGCTAAATGGTGGCTGG + Intergenic
963119754 3:141766129-141766151 TGTAAATGTTAAATGTCCACTGG - Intergenic
964078644 3:152723839-152723861 TGTCAAGGGAAGAAGGCCGCTGG - Intergenic
973712429 4:53642969-53642991 AGTCAATGTTAAGTGGCCTCTGG - Intronic
979736322 4:124090289-124090311 TGTCAATGGAAAATAACAGCAGG + Intergenic
984813226 4:183813752-183813774 AGTCAATGCTAATTGGCGGCTGG + Intergenic
985695447 5:1337650-1337672 TGTCACTGGTGAAAGGCCCCTGG - Intronic
992864059 5:80940206-80940228 TGTTACTGCTAAATGGCCCCTGG + Intergenic
1000782827 5:165504936-165504958 TGGCAATGGTAAATTGAAGCAGG + Intergenic
1000920294 5:167129743-167129765 TGTCAATGCTTAATGGACTCTGG + Intergenic
1003354978 6:5359800-5359822 TGTGAATGGTAAGGGGCTGCTGG + Intronic
1012629973 6:101453702-101453724 TGTCAATTGGAAATGACCCCAGG + Intronic
1015124814 6:129742162-129742184 TGTCAATGGTGAGTGGCAGTGGG - Intergenic
1016879680 6:148898780-148898802 TATCAATGATAACTGGCCCCTGG - Intronic
1020078249 7:5272923-5272945 TGACCACGGCAAATGGCCGCTGG + Intergenic
1022221358 7:28316824-28316846 TGTATATGGTACATGGCAGCTGG + Intronic
1025200643 7:56959266-56959288 TGGCCACGGCAAATGGCCGCTGG - Intergenic
1025671300 7:63617666-63617688 TGGCCACGGCAAATGGCCGCTGG + Intergenic
1033992940 7:147310336-147310358 TGTCAATGGTAAATGGCCGCAGG - Intronic
1038251606 8:25910366-25910388 TGTAAGTCGTAAATTGCCGCTGG - Intronic
1040636976 8:49286110-49286132 TGTTACTGGGAAATGGCTGCAGG + Intergenic
1043084471 8:75811140-75811162 TGTCAATGAGAAATGGCTCCTGG - Intergenic
1050539014 9:6654124-6654146 TGTCCTTAGTAAATGGCCACAGG - Intergenic
1185615398 X:1418882-1418904 TGTCAATGGAAAAAGGCAGTTGG + Intronic
1197794817 X:130287404-130287426 AGTCAGTGGGAAATGGCCTCAGG - Intergenic