ID: 1033999513

View in Genome Browser
Species Human (GRCh38)
Location 7:147394649-147394671
Sequence TTGGATAGAAACACCCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033999513_1033999516 23 Left 1033999513 7:147394649-147394671 CCATAATGGGTGTTTCTATCCAA 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1033999516 7:147394695-147394717 ATATAATAGTAATTGATTGGTGG 0: 1
1: 0
2: 2
3: 24
4: 347
1033999513_1033999515 20 Left 1033999513 7:147394649-147394671 CCATAATGGGTGTTTCTATCCAA 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1033999515 7:147394692-147394714 AAGATATAATAGTAATTGATTGG 0: 1
1: 0
2: 0
3: 32
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033999513 Original CRISPR TTGGATAGAAACACCCATTA TGG (reversed) Intronic
903436227 1:23351744-23351766 TTGGAAAGCAACACCCGTTTGGG + Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
909744307 1:79074113-79074135 ATAGATAGAAAAACCCATAAGGG - Intergenic
910140895 1:84026558-84026580 TTGGATGAAAGCAACCATTATGG - Intergenic
916832464 1:168507057-168507079 TTGAATAGAAAGACCCAGCAAGG + Intergenic
916957636 1:169856104-169856126 TTGAAGACATACACCCATTATGG + Intronic
920863791 1:209734296-209734318 TTCTATAGAAACAGCCATGAAGG + Exonic
923936970 1:238772869-238772891 TTGGGTTGAAACAACAATTAAGG - Intergenic
1064675591 10:17756733-17756755 GTGGCTAGAAGTACCCATTATGG - Intronic
1065408543 10:25395534-25395556 TTTGATAGAAACATTCAGTATGG + Intronic
1072094163 10:92160717-92160739 TTGGACATTAACACCCATAAAGG + Intronic
1080667258 11:34346572-34346594 TGGGAAAGAAACACCCAGGATGG - Intronic
1084917219 11:72437879-72437901 AAGTATGGAAACACCCATTAGGG + Intergenic
1087349754 11:97016855-97016877 TTGGATAGAACAAACCGTTAAGG + Intergenic
1087691619 11:101326903-101326925 ATGAATAAAAACACCAATTATGG - Intergenic
1088530137 11:110799547-110799569 TTTGATAAAAATACCCACTAAGG + Intergenic
1093582147 12:20795022-20795044 TTGGACAGTAACAGCAATTATGG - Intergenic
1097855499 12:64457237-64457259 TTGACTATAAACACCCTTTATGG + Intronic
1097971733 12:65640148-65640170 TTGGCTTTAAACACCCATAAGGG - Intergenic
1098157067 12:67610031-67610053 TTGAATAGAAACATCTTTTAGGG + Intergenic
1098312095 12:69158631-69158653 TTGGATAGACACACCTTTCAAGG - Intergenic
1100300227 12:93300243-93300265 TTACACAGAAAGACCCATTAAGG + Intergenic
1113219884 13:108087795-108087817 TTGGATAGAATAATCCATTGGGG - Intergenic
1116397380 14:44462841-44462863 ATGGTCAGAAACACCTATTATGG - Intergenic
1118670452 14:68120440-68120462 TTAGATAGAAATTCTCATTAGGG + Intronic
1121220593 14:92282124-92282146 TGGGAAGGAAACACCCATTTAGG - Intergenic
1121916090 14:97837963-97837985 TTGGATATAAACACCCTTTTGGG + Intergenic
1123754278 15:23384788-23384810 ATGAAAAGAAACATCCATTAAGG - Intergenic
1127929135 15:63579209-63579231 TTGGATGGGAAGACCCAATATGG + Intronic
1129570966 15:76683090-76683112 ATGGATAGGAACATCCATTGTGG + Intronic
1130579975 15:85127742-85127764 TTGAATTGAAACACCAATTTGGG - Intronic
1131426741 15:92351647-92351669 CTGCATAGAAACCCCAATTATGG - Intergenic
1133402105 16:5495822-5495844 TTGGCTAAAGAAACCCATTAAGG + Intergenic
1134462087 16:14438222-14438244 ATGAAAAGAAACATCCATTAAGG + Intronic
1139239633 16:65377878-65377900 TTGGATAGAGATACCCATAGAGG - Intergenic
1148001555 17:44390516-44390538 CTGGATGGAAACACACACTAAGG + Intergenic
1148367564 17:47067633-47067655 TTGCATCAAAAAACCCATTAAGG - Intergenic
1150275038 17:63891699-63891721 TTCGATAGAAAATACCATTAAGG + Intergenic
1153568179 18:6441615-6441637 TTGGCTGGAAACATCCTTTATGG + Intergenic
1159585380 18:70278779-70278801 TTGGAAAGATACACACTTTAAGG - Intergenic
927355465 2:22167839-22167861 TTGGGTAGAATACCCCATTAAGG - Intergenic
928184567 2:29097874-29097896 TTGGTGAGAAAGACCCATGAGGG + Intronic
932439199 2:71721133-71721155 TTGGAATGGAACAGCCATTAAGG + Intergenic
936377204 2:111951678-111951700 TTGGATATATATACCCAGTATGG + Intronic
939886008 2:147682592-147682614 TTGGAAAGTAACACAAATTAAGG - Intergenic
942381935 2:175400729-175400751 TGGGATTGAAACATCCATTGCGG + Intergenic
944022147 2:195118258-195118280 AGGGATAGAAACATCCTTTAAGG + Intergenic
944369217 2:198962093-198962115 TTGGATAGAATGACTCTTTAGGG + Intergenic
946852561 2:223921283-223921305 CTGGATAGAAACAAGCCTTAGGG + Intronic
1170181435 20:13534889-13534911 CTGGATAGAAACAATGATTAAGG + Intronic
1177468739 21:21526512-21526534 ATGGATAGAAAGACTCAATATGG + Intronic
1183326289 22:37196524-37196546 ATGGATATAAACACCCTTTGGGG - Intronic
956244185 3:67162891-67162913 ATGGATAGAAAGACTCAATATGG - Intergenic
960499768 3:118423037-118423059 GTGGAGAGAAAAACCCCTTAGGG + Intergenic
962155178 3:132939478-132939500 TGGAAAAGAAACACTCATTAAGG - Intergenic
967390546 3:188950001-188950023 TTGGATAGAGACCCTCAGTAAGG - Intronic
973655908 4:53047698-53047720 TTGGATAGAAACAACCTAAATGG - Intronic
977738831 4:100452429-100452451 TTGGATAGGAACACCTTTAAGGG - Intronic
978141909 4:105327519-105327541 TTGAATTGAAGTACCCATTAAGG + Intergenic
979114330 4:116802056-116802078 TTGGATGGAAGCACTGATTATGG - Intergenic
980050591 4:128035592-128035614 ATGGATTCAAACACCCATTCTGG + Intronic
988080217 5:26404745-26404767 TTGGATAGATATACACATAAAGG + Intergenic
988121949 5:26975641-26975663 TTGGACAGATATACCCATTGAGG + Intronic
989362963 5:40624452-40624474 TTGGATAGTAACATCCATATAGG - Intergenic
990025390 5:51181331-51181353 TGTGAGAGAAACAGCCATTAGGG - Intergenic
996087525 5:119320263-119320285 TTGGAGAGAAAAAGCCTTTAGGG - Intronic
996520367 5:124419360-124419382 TTGGATAGAAAAGCCAATTTGGG + Intergenic
998940682 5:147279656-147279678 TTGGTTAAAGAAACCCATTATGG - Intronic
999384180 5:151142706-151142728 ATGGATGGAGACACCCATGACGG + Intronic
1005203827 6:23378125-23378147 TTGGATAAAAGCAACCATTTAGG - Intergenic
1008009665 6:46452601-46452623 TTGGGTAGAAACAGCCAGTAGGG + Intronic
1009899272 6:69792112-69792134 TTGGATAAAGAAACCCATAAAGG + Intronic
1010282470 6:74037467-74037489 GTGGAGAGAAACTCCCATTTTGG - Intergenic
1014678056 6:124392422-124392444 TTGGTTAGAAATAACCCTTAAGG + Intronic
1016406238 6:143734055-143734077 GTGGATGGAAAGACTCATTATGG + Intronic
1016544509 6:145205910-145205932 TAGGATAGAAGCATCTATTAGGG - Intergenic
1018863281 6:167728092-167728114 CTGGATAGAAAGACTCAATATGG + Intergenic
1019607046 7:1915204-1915226 TTGAAAAGCAACATCCATTAGGG - Intronic
1021271151 7:18588026-18588048 TGGAATAATAACACCCATTAAGG + Intronic
1021368465 7:19811252-19811274 TTGGTAATAAACACACATTAAGG + Intergenic
1021404862 7:20253319-20253341 GTAGATAGATACAGCCATTATGG + Intergenic
1022790287 7:33681740-33681762 TGGGATAGAGAGACGCATTATGG + Intergenic
1022896780 7:34758014-34758036 TGGGATTGAAACACCAGTTATGG - Intronic
1027883884 7:83877466-83877488 TTGTATATATACACACATTAGGG + Intergenic
1032748158 7:134808637-134808659 TTGGATAGAAAGACTTATTCAGG - Intronic
1033929112 7:146502131-146502153 TTGGATGGAAATAGACATTATGG - Intronic
1033999513 7:147394649-147394671 TTGGATAGAAACACCCATTATGG - Intronic
1038396269 8:27247803-27247825 TTGGATAGAATCTCCCATTGAGG - Intronic
1040138920 8:43887605-43887627 TTGGCTGGAAACACTCATTTTGG + Intergenic
1043663340 8:82775086-82775108 TTAAATAGAAACACACATTTAGG - Intergenic
1046614751 8:116463753-116463775 TTGGAGAAAAACACCCGTGATGG + Intergenic
1046776555 8:118169903-118169925 TTTTATATAAACACACATTATGG + Intergenic
1049879071 8:145049772-145049794 TTGGATAGAAACACAATTTGAGG - Intergenic
1057919517 9:99085415-99085437 TTGGATGGAAACATCCTTTTTGG + Intergenic
1058601372 9:106674369-106674391 TTGGATAAAACCACCAATTATGG + Intergenic
1062153209 9:135032091-135032113 TTGGATACAAACACCCTTTAAGG - Intergenic
1187393363 X:18900396-18900418 TTGAATAGAAACTCCCACTGAGG + Intronic
1188707903 X:33357883-33357905 TTGGCTGGCACCACCCATTAGGG + Intergenic
1197621300 X:128752749-128752771 TGGGAGAGGAACACCCAATATGG + Intergenic