ID: 1034000582

View in Genome Browser
Species Human (GRCh38)
Location 7:147408258-147408280
Sequence TTCTCCCTGGGATCTAGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034000574_1034000582 14 Left 1034000574 7:147408221-147408243 CCAAAATCAAAGTATGCACAAGG 0: 1
1: 0
2: 3
3: 28
4: 393
Right 1034000582 7:147408258-147408280 TTCTCCCTGGGATCTAGGTTGGG 0: 1
1: 0
2: 0
3: 18
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034000582 Original CRISPR TTCTCCCTGGGATCTAGGTT GGG Intronic
902293653 1:15451439-15451461 GACTCCCTGGGATCTGGCTTGGG + Intergenic
902500320 1:16906763-16906785 TTCTCCCTGGAATATAAGATGGG + Intronic
908570823 1:65408292-65408314 TTGGCACTGGGATCTCGGTTTGG - Intronic
909691607 1:78413476-78413498 TTCTCCCTGGGATGCAAGTTTGG + Intronic
911673074 1:100629089-100629111 TTCACCATGGGATTTAGGTAAGG + Intergenic
912275657 1:108255670-108255692 TTATCCCTGGGCTGTAAGTTTGG - Intergenic
912292567 1:108438679-108438701 TTATCCCTGGGCTGTAAGTTTGG + Intronic
913049297 1:115102786-115102808 TCCTCCCTGGACTCTATGTTTGG + Intergenic
913068928 1:115282973-115282995 TGCTCCCTCGGAGCTGGGTTTGG + Intergenic
913573908 1:120150192-120150214 TTATCCCTGGGATGCAAGTTTGG - Intergenic
913645395 1:120849847-120849869 TTCTCCCTGGAATGTAAGATGGG - Intergenic
913708485 1:121453777-121453799 TTATCCCTGGGATGCAGGATCGG - Intergenic
914096019 1:144544914-144544936 TTCTCCCTGGAATATAAGATGGG - Intergenic
914295167 1:146314992-146315014 TTATCCCTGGGATGCAAGTTTGG - Intergenic
914302505 1:146389051-146389073 TTCTCCCTGGAATATAAGATGGG + Intergenic
914517243 1:148384392-148384414 TTCTCCCTGGAATATAAGATGGG - Intergenic
914530969 1:148523716-148523738 TTCTCCCTGGAATGTAAGATGGG + Intergenic
914556208 1:148765775-148765797 TTATCCCTGGGATGCAAGTTTGG - Intergenic
914616626 1:149364458-149364480 TTATCCCTGGGATGCAAGTTTGG + Intergenic
915000803 1:152588406-152588428 TTATTCCTGGCATGTAGGTTTGG + Intronic
917598498 1:176553031-176553053 TTCTCCCTGGCATCGAGGGTGGG + Intronic
918194873 1:182211943-182211965 CTCTGCCTGGGATGTTGGTTTGG + Intergenic
918386594 1:184014202-184014224 GTTCCCCTGGGATCTAGATTTGG - Intronic
919136218 1:193511038-193511060 TTATCCCTGGGATGTAAGATTGG - Intergenic
921242439 1:213199309-213199331 TTATCCCTGGGATATAAGGTTGG + Intronic
921457070 1:215384541-215384563 TTATCCCTGGGATATAAGTATGG + Intergenic
921978703 1:221230745-221230767 GTTTCCCTGGCATCTATGTTTGG + Intergenic
923175128 1:231456251-231456273 TTATCCCTGGCATTCAGGTTTGG + Intergenic
923663534 1:235979323-235979345 TCCTGCCTGGGATCTAGAGTGGG - Intronic
924748640 1:246863271-246863293 TTGTCCCTGGGTTCTCTGTTTGG - Intronic
1066753048 10:38679409-38679431 TTATCCCTGGGATGCAAGTTTGG + Intergenic
1067089756 10:43260561-43260583 TTCTCCGTGGGGTCTGGGTCTGG - Intronic
1069746375 10:70717459-70717481 ACCTCCCTGGCATCTAGGTGTGG + Intronic
1071110251 10:82147327-82147349 TGATCCCTGGGATCTGGCTTAGG + Intronic
1071881871 10:89908118-89908140 TTATCCCTGGGATATAAGGTTGG - Intergenic
1076882258 10:133245286-133245308 CCCTCCCTGGGATCTGGGCTGGG - Intergenic
1077233364 11:1468509-1468531 CTCTCTCTGGGAACTGGGTTTGG + Intergenic
1081166877 11:39818620-39818642 CTCTCCCTTGGCTCTAGGTATGG + Intergenic
1085856030 11:80177214-80177236 TTATCCCTGGGATGTAAGGTTGG - Intergenic
1086532708 11:87804473-87804495 TTCTCCCTGGGACATAGGACAGG + Intergenic
1087155472 11:94897490-94897512 TTCTCCCTAGGATCTGGACTTGG + Intergenic
1087918269 11:103835251-103835273 TTATCCCTGGGATGCAAGTTTGG + Intergenic
1089870047 11:121664533-121664555 TTCTCTCTGACATCTATGTTTGG - Intergenic
1090946232 11:131431825-131431847 AACTCCCTGGGAGCTGGGTTGGG - Intronic
1091134142 11:133172956-133172978 TTTTGCCTGGGATATAGATTTGG + Intronic
1094290138 12:28838828-28838850 TTATCCCTGGGATATAAGATTGG + Intergenic
1095481518 12:42641141-42641163 GTCTCCCTGTGAACTAGGTAAGG + Intergenic
1097336261 12:58386770-58386792 TTATCTTTGGGATCTAGATTTGG + Intergenic
1098072736 12:66693523-66693545 TTCTCCCTTGAATCTATTTTAGG + Intronic
1098267826 12:68740275-68740297 TTCTTACTGGGTTCTAGGTTGGG + Intronic
1098347549 12:69522051-69522073 TTATCCCTGGGATGCAAGTTTGG - Intronic
1099956996 12:89360661-89360683 TTTTCCCTGGGAAATTGGTTAGG - Intergenic
1101418735 12:104531610-104531632 TTCTCCCTGAGATCTCTCTTGGG + Intronic
1102811437 12:115827565-115827587 TTCCACCTGAGATCTAGTTTGGG - Intergenic
1106156912 13:27167888-27167910 GTCTCACTGGGATCCAGGTAAGG - Intronic
1108107971 13:47033672-47033694 TTCTTCCTGGGCTCTGGGCTAGG + Intergenic
1108686021 13:52819134-52819156 TTCTCCCTGTGGCCTGGGTTGGG - Intergenic
1111775590 13:92657435-92657457 TGCACCCTGGGATCTAGACTTGG - Intronic
1112782143 13:102912814-102912836 TTCTACCTGGAATACAGGTTTGG - Intergenic
1113275588 13:108725851-108725873 TTCTCCCTGTGCTGTAGCTTGGG + Intronic
1113492334 13:110702311-110702333 TTGTCCCTGGAATCAAGATTTGG - Intronic
1114422634 14:22597603-22597625 TTTTCCCTGGAAAATAGGTTGGG + Intergenic
1116686161 14:48041186-48041208 ATTTCCCTGGGATATAGCTTAGG - Intergenic
1116863188 14:50010680-50010702 TTCTCACTGGCACCTAGGTAGGG - Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1121119107 14:91364731-91364753 TGCTTCCTGTGATCTGGGTTGGG - Intronic
1122056967 14:99105947-99105969 TTCTCCCTGAGATCAAGGACAGG - Intergenic
1122940634 14:104979485-104979507 GCCTCCCTGGGATCTAGCTTGGG + Intergenic
1124474029 15:30015748-30015770 TTATCCCTGGGATGCAAGTTTGG - Intergenic
1125271788 15:37947176-37947198 TTATCCCTGGGATGCAAGTTTGG - Intronic
1127820411 15:62649731-62649753 TTCTCCATGGGATGTTGGTCTGG + Intronic
1129460216 15:75696775-75696797 TTCTTCCTGAGATCTAGGCCTGG + Intronic
1130366676 15:83246916-83246938 TTATCCCTGGGATGCAAGTTTGG - Intergenic
1131988880 15:98072933-98072955 TTCTTCCTGGGATGCAGGGTTGG - Intergenic
1132189935 15:99845310-99845332 TGCACCCTGGGATCTGGATTTGG + Intergenic
1133151116 16:3831631-3831653 TTCTCTCATTGATCTAGGTTGGG - Intronic
1133415929 16:5607026-5607048 ATCTCCCTGGGACCTGGCTTAGG + Intergenic
1138258701 16:55596474-55596496 TTATCCCTGGGATGCAAGTTTGG + Intergenic
1138315884 16:56069711-56069733 TTCTCCCTGGGATTAAGGTCAGG - Intergenic
1139259259 16:65576480-65576502 TTCTCCCTTGGACCTTGGTATGG - Intergenic
1143131923 17:4684058-4684080 TTCTCCATGGGTTCCAGGGTGGG - Intronic
1149235372 17:54583877-54583899 TTATCCCTGGGATGCACGTTTGG + Intergenic
1149365181 17:55936673-55936695 TTCTACCTGGGCTCTGGATTTGG - Intergenic
1149411618 17:56414011-56414033 TTATCCCTGGGATGCAAGTTTGG - Intronic
1150792814 17:68212595-68212617 TTCACCCTGTCATCCAGGTTGGG + Intergenic
1154378384 18:13827641-13827663 GGCTCCCTGGGCTATAGGTTGGG - Intergenic
1156053622 18:32970733-32970755 TTCTCCCTGGGTTGTATTTTAGG - Intronic
1158749426 18:60241778-60241800 TTCTCTCTGGGATGGAAGTTTGG - Intergenic
1160250136 18:77196114-77196136 TTATCCCTGGGATGTAAGTTTGG - Intergenic
1160300368 18:77672502-77672524 TTTTCCTTTTGATCTAGGTTTGG + Intergenic
1168093452 19:54100717-54100739 TTCTCCCTGGGTTCCTGGCTGGG - Intronic
925623417 2:5817365-5817387 TTCTCCCTGGGGCCTAGGATGGG + Intergenic
925744506 2:7032918-7032940 TTTTCCCTGGGCTGTAGGTAGGG + Intronic
927348212 2:22072498-22072520 TTATCCCTGGGATGTAAGTGTGG + Intergenic
928175820 2:29033731-29033753 GTCTCCCTGGGATTTGGGTTGGG - Intronic
928490907 2:31782035-31782057 TTATCCCTGGGATGCAGGGTTGG + Intergenic
928713627 2:34035301-34035323 TTCTCTCTGGGTTCTGGTTTTGG - Intergenic
929872137 2:45768084-45768106 TGATCTCTGGCATCTAGGTTTGG - Intronic
933378709 2:81515516-81515538 TTCTCACAGGGATATAGGTTAGG + Intergenic
933411254 2:81927817-81927839 TTCTGCCTGGGGTCTATGTAAGG - Intergenic
934624437 2:95835173-95835195 TTCTCCCTGGCATGGAGGTCTGG + Intergenic
934809223 2:97266555-97266577 TTCTCCCTGGCATGGAGGTCTGG - Intergenic
934828282 2:97490614-97490636 TTCTCCCTGGCATGGAGGTCTGG + Intergenic
936031634 2:109076107-109076129 TTATCCCTGGGATGCAGGTTTGG + Intergenic
936140202 2:109932913-109932935 TTCTACCTGGCAGCCAGGTTTGG + Intergenic
936176891 2:110230858-110230880 TTCTACCTGGCAGCCAGGTTTGG + Intergenic
936204494 2:110438573-110438595 TTCTACCTGGCAGCCAGGTTTGG - Intronic
936782981 2:116055772-116055794 TTATCCCTGGGATTTAAGGTTGG - Intergenic
937860313 2:126703167-126703189 TTCTCTTTGGGATCCTGGTTAGG - Intergenic
938315437 2:130323662-130323684 TTATCCCTGGGATACAAGTTTGG - Intergenic
941077754 2:161025293-161025315 TTATCCCTGGGATGTAAGGTTGG + Intergenic
941221870 2:162792108-162792130 TTATCCCTGGGATGCAAGTTTGG - Intronic
942565458 2:177261644-177261666 TTATCCCTGGTTTCCAGGTTGGG - Intronic
945761243 2:213918093-213918115 TTATCCCTGGGATGTAAGCTCGG - Intronic
946231344 2:218292764-218292786 TTCCCCCTGGGAACTAGGAGGGG - Intronic
946620195 2:221553541-221553563 TTCTCCCAGGGCTCCAGATTGGG - Intronic
948851810 2:240711913-240711935 CTCTCCCTGGGGACTGGGTTGGG + Intergenic
1170050712 20:12141819-12141841 TTATCCCTGGGATGCAAGTTTGG - Intergenic
1170413656 20:16117237-16117259 TTATCCCTGGGATGTAAGGTTGG - Intergenic
1176096232 20:63345756-63345778 TCCGCCCTGGGCTCTGGGTTCGG - Exonic
1176289073 21:5034716-5034738 TTCTCCCTGGGATCCAGCAGTGG - Intronic
1176900095 21:14430284-14430306 TTATCCCTGGTATCTAAGATTGG + Intergenic
1176999449 21:15593923-15593945 TTATCCCTGGGATCTAAGGATGG + Intergenic
1177021273 21:15861249-15861271 ATCTCCCTCCTATCTAGGTTAGG - Intronic
1179868162 21:44228888-44228910 TTCTCCCTGGGATCCAGCAGTGG + Intronic
1180542819 22:16467459-16467481 TTATCCCTGGGATGCAAGTTTGG + Intergenic
1180884631 22:19232593-19232615 TGCTCCCTTGCTTCTAGGTTGGG - Exonic
1184334438 22:43845004-43845026 TTCTCCCTGGGAGTTACCTTTGG - Intronic
950486891 3:13279094-13279116 TGCTCCCTGGGATTTGGGTCTGG + Intergenic
951059449 3:18188253-18188275 TTCTGCCAGGAATCTTGGTTAGG + Intronic
951946805 3:28147079-28147101 ATCTACCTGGAATCTTGGTTTGG - Intergenic
952012437 3:28915884-28915906 CTCTCCATGGGAACTAGGTCAGG - Intergenic
952582155 3:34847127-34847149 TTATACCAGGGATCAAGGTTAGG + Intergenic
953853835 3:46485567-46485589 TTCTCCCTAGGAGCCATGTTGGG - Intergenic
955797431 3:62652349-62652371 TGTTCCATGGGATCTAGGTGGGG - Intronic
956556416 3:70528238-70528260 CTCTCCCTAGGATCTGGGTAGGG - Intergenic
956931416 3:74047742-74047764 TTCTCCTTGGAAGCCAGGTTGGG + Intergenic
959229853 3:103633761-103633783 TTATCCCTGGGATATAAGTTTGG - Intergenic
959463268 3:106652464-106652486 TTATTCCTGGGATGTAGGTTTGG + Intergenic
964262080 3:154850827-154850849 TTGTCAATGGGATGTAGGTTTGG - Intergenic
964934668 3:162067883-162067905 TTATCCTTGGGATGTAGGGTTGG + Intergenic
966285844 3:178294109-178294131 TACTCCTAGGGACCTAGGTTAGG - Intergenic
966478946 3:180383139-180383161 TTCCCCCTAGAATCTAGATTAGG - Intergenic
966652635 3:182318253-182318275 TTATCCCTGGGATGTAAGGTTGG - Intergenic
966842918 3:184104165-184104187 CTCCACCTGGGCTCTAGGTTTGG + Exonic
967067046 3:185927560-185927582 TGCTTCCTGGGCCCTAGGTTAGG - Intronic
967148708 3:186628536-186628558 TTCTCCTTGGGAGTTAGTTTTGG + Intergenic
969453736 4:7289284-7289306 TTCTCCCTGGGAATCAGGCTGGG + Intronic
972010516 4:34174790-34174812 TTATCCCTGGGATGTAAGTTTGG + Intergenic
972919006 4:43914910-43914932 TCCTCCCTGGGATACAAGTTTGG + Intergenic
974297177 4:60015857-60015879 TTATCCCTGGGATGAAAGTTTGG - Intergenic
975351379 4:73351126-73351148 GGCTCCCTTGGATCTAGGTTTGG + Intergenic
977948317 4:102939721-102939743 TTATCCCTGGGATGCAAGTTTGG + Intronic
978160845 4:105546149-105546171 CTCTCCATGGGACCTAGTTTGGG - Intergenic
978867927 4:113537570-113537592 TTTTCCCTGGGATTTAGGAATGG - Intronic
979208598 4:118073050-118073072 TTATCCCTGGGATGTAAGGTTGG - Intronic
983853237 4:172609466-172609488 TTATCCCTGGGATGCAAGTTCGG - Intronic
984144132 4:176040609-176040631 TTATCCCTGGGATGTAAGTTTGG - Intergenic
989778550 5:45237421-45237443 TTCTCCCTGGGATGCAAGGTTGG - Intergenic
990240664 5:53813266-53813288 TCTTCCCTGGTTTCTAGGTTTGG + Intergenic
990285996 5:54301095-54301117 TTGGCCCTGAAATCTAGGTTAGG + Intronic
992191039 5:74292157-74292179 TCCTCCCTGGCATCCAGGCTAGG + Intergenic
993864631 5:93177776-93177798 TGCTCACTGGGAACTAGGCTGGG - Intergenic
995636562 5:114200126-114200148 TTCTCCTTGGAATGTAAGTTTGG + Intergenic
995666725 5:114550840-114550862 TTATCCCTGGGATTTAAGGTTGG + Intergenic
997204737 5:132040027-132040049 TTATCCCTGGGATGCAAGTTTGG - Intergenic
997688800 5:135811208-135811230 TTCTCCCTGGGAAGGAGGATGGG + Intergenic
997926337 5:138033571-138033593 TTCTCTCTGGAGTCTAGGTCAGG - Intronic
999569128 5:152898987-152899009 TTTTCCTTGTGCTCTAGGTTTGG - Intergenic
1000173336 5:158725773-158725795 TGCTCTCTGGGTTCAAGGTTTGG + Intronic
1000571488 5:162920053-162920075 TTCTCCCTGGGATGCAAGTATGG - Intergenic
1004825922 6:19421199-19421221 TTATCCCTGGGATGTAAGGTTGG - Intergenic
1006733792 6:36257018-36257040 TTTTGCCTGGGATCTGGGTGTGG + Intronic
1007313029 6:40961728-40961750 TACTCCAGGGGATCTGGGTTGGG - Intergenic
1009332605 6:62442359-62442381 TTATCCCTGGGATATAAGGTTGG - Intergenic
1010023116 6:71184349-71184371 TTATCCCTGGGATGCAAGTTTGG + Intergenic
1010820995 6:80415595-80415617 TTATCCCTGGGATGCAAGTTTGG - Intergenic
1012155164 6:95810422-95810444 TTATCCCTGGGATGCAAGTTTGG + Intergenic
1015714453 6:136177764-136177786 GTCTCCCTGGGGTCTATATTTGG - Intronic
1015962516 6:138664870-138664892 TTCTCCCTGGGGTCAGGGTGTGG + Intronic
1016526189 6:145004138-145004160 TTCCCCTTGGGATTTAGGGTTGG + Intergenic
1016534731 6:145097551-145097573 ATCTCCTTGGGAGCTAGTTTGGG - Intergenic
1016952814 6:149597555-149597577 TTTTCCCTGGGATATAGATGAGG - Exonic
1018332629 6:162747765-162747787 TTTACCTTGGGATCTAGGTCTGG - Intronic
1020812470 7:12864124-12864146 TTCTCCCTGGTTTGAAGGTTGGG + Intergenic
1022480684 7:30741249-30741271 TTTTCCCTGGGATGTAGGAAGGG - Intronic
1024197034 7:47069373-47069395 GTCTCCCTGGCATGTAGGATTGG + Intergenic
1031304077 7:120102045-120102067 TTCTCCCTGGAAGTTAGGTGGGG + Intergenic
1033570812 7:142626770-142626792 TTCTACCTGGGAGCTTGGGTGGG + Intergenic
1033787588 7:144752452-144752474 TTATCCCTGGGATCTAAGGCTGG - Intronic
1034000582 7:147408258-147408280 TTCTCCCTGGGATCTAGGTTGGG + Intronic
1036224820 8:6949035-6949057 TCCTCCCTGGGATCTGTATTGGG + Intergenic
1036235533 8:7036370-7036392 TCCTCCCTGGGATCTGTATTGGG + Intergenic
1036236989 8:7047617-7047639 TCCTCCCTGGGATCTGTGTTGGG + Intergenic
1039820843 8:41133586-41133608 TCCTCCCTGGGATGCAAGTTTGG + Intergenic
1040772667 8:50997647-50997669 TACTCCCTTGCATTTAGGTTTGG + Intergenic
1043709020 8:83390785-83390807 TTCTTCTTGAGATCTAAGTTTGG - Intergenic
1044408397 8:91857189-91857211 GTCTTCCTGGGATCTAGTATAGG + Intergenic
1044766570 8:95581903-95581925 TCCTCACTGGGCTCTAGATTGGG + Intergenic
1049457502 8:142700976-142700998 TTCTCCCTTGGGTCTGGGTTGGG - Intronic
1050003825 9:1106974-1106996 TTATCCCTGGGATATAAGGTTGG - Intergenic
1052702522 9:31954603-31954625 TTATCCCTGGGATGGAAGTTTGG + Intergenic
1052883121 9:33617888-33617910 TTCTACCTGGGAGCTTGGGTGGG + Intergenic
1054955041 9:70899628-70899650 TTCTCCCTGAGGCGTAGGTTAGG - Intronic
1055217715 9:73886936-73886958 TTATCCCTGGGATGCAAGTTTGG - Intergenic
1057023014 9:91715191-91715213 TTCTGCCTGGGAACTTGGGTTGG - Intronic
1057311367 9:93945255-93945277 ATCTACCTGGGATCTATCTTTGG - Intergenic
1057629572 9:96708449-96708471 TTCTCCCTGAGATCTCAGTGGGG + Intergenic
1058198772 9:102012181-102012203 TTATCCCTGGGATGGAAGTTTGG + Intergenic
1186768466 X:12794270-12794292 TTTTGCCTGGGAGCTTGGTTAGG + Intronic
1187893492 X:23959599-23959621 ATCTCTCTGGGATTTTGGTTAGG + Intergenic
1188806638 X:34598769-34598791 TTATCCCTGGGATGCAAGTTTGG - Intergenic
1188964428 X:36533987-36534009 TTCTCCCTGGGATGGAGGGATGG - Intergenic
1189256004 X:39639848-39639870 TTCCCCCTTGGCTTTAGGTTTGG + Intergenic
1191877955 X:65815321-65815343 TTATCCCTGGGATGTAAGGTTGG + Intergenic
1192866253 X:75135645-75135667 TTATCCCTGAGATGTAAGTTTGG + Intronic
1193347038 X:80415618-80415640 TTATCCCTGGGATGTAAGGTTGG - Intronic
1193617053 X:83702084-83702106 TTCTCCCTGTGATACAAGTTTGG - Intergenic
1193809402 X:86034366-86034388 TTGTCCCTGGGAGTTTGGTTTGG - Intronic
1194517509 X:94874302-94874324 TTATTCCTGGGATGTAGGGTTGG + Intergenic
1194797650 X:98232381-98232403 TTATCCCTGGGATGCAAGTTTGG + Intergenic
1194918131 X:99729616-99729638 TTATCCCTGGGATGCAAGTTTGG + Intergenic
1195024178 X:100859256-100859278 TTATCCCTGGGATGCAAGTTTGG - Intronic
1196234018 X:113258222-113258244 TTATCCCTGGGATGCAGGTTTGG - Intergenic
1201179395 Y:11331722-11331744 TTCTCTCTGGGGTCTCGGTCTGG + Intergenic
1201183708 Y:11376395-11376417 TTATCCCTGGGATGCAAGTTTGG + Intergenic