ID: 1034001952

View in Genome Browser
Species Human (GRCh38)
Location 7:147424113-147424135
Sequence ATGGAGCAGCGGAATGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034001952 Original CRISPR ATGGAGCAGCGGAATGAAGT AGG (reversed) Intronic
900326450 1:2110752-2110774 TGGGAGCAGCGGAGTGAAGGGGG + Intronic
900626397 1:3610683-3610705 ATGGGGGAGCTGAATGGAGTTGG - Intronic
902177903 1:14665092-14665114 TTGGGGCAGCGGAATAAAGAGGG - Intronic
905847698 1:41246505-41246527 AAGGAGCAGCTGAAAGGAGTTGG + Intergenic
905915923 1:41684226-41684248 AAGCAGCAGAGGAAGGAAGTGGG + Intronic
906111628 1:43327011-43327033 TTGAAACAGAGGAATGAAGTTGG + Intergenic
906968364 1:50483649-50483671 ATGGAGATGTGGAATCAAGTTGG + Intronic
908206538 1:61856082-61856104 ATGGTGTAGCAGAAAGAAGTGGG + Exonic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
910615396 1:89192297-89192319 ATGAAGCTGTAGAATGAAGTAGG + Intronic
910878611 1:91902200-91902222 ATGGAGGAGTGAAAAGAAGTAGG - Intronic
915120683 1:153628205-153628227 ATGGTGCAGGGGAAAGAGGTGGG - Intronic
916352854 1:163871682-163871704 ATGAAGCAGAGAACTGAAGTTGG + Intergenic
917649875 1:177065797-177065819 ATAAAGCAGAGGAATGAACTAGG + Intronic
918562054 1:185880740-185880762 ATGAAATAGGGGAATGAAGTTGG + Intronic
921346658 1:214193193-214193215 AGGGAGCAGAGGAATTAAGCAGG + Intergenic
922615503 1:226958858-226958880 ATGGAGCAGCAGGAAGAAGTAGG + Intronic
924247751 1:242101402-242101424 ATGGGGCAGCTGAAAGAAGGGGG + Intronic
1063026454 10:2183612-2183634 ATGGGGCAATGGAATGGAGTGGG + Intergenic
1063226207 10:4017273-4017295 CTGGAGCAGAGCAATGAATTTGG - Intergenic
1063561246 10:7130224-7130246 AGGTAGCAGGGGAGTGAAGTGGG + Intergenic
1065825729 10:29568873-29568895 AGGGAGCAGAGGAAGGAAGGAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071761336 10:88611007-88611029 AGGTAGCAGGGGAGTGAAGTGGG - Intergenic
1071987552 10:91067620-91067642 ATGGAGCAGAGGAATCAATAAGG + Intergenic
1079961676 11:26931949-26931971 AGGGAGCAAAGGAATGAAGAAGG + Intergenic
1081635376 11:44718076-44718098 CTGGAGCAGAGGCATGAAGGAGG - Intergenic
1081854004 11:46292591-46292613 ATGGAGCAGAGAAATGACATAGG + Intronic
1083042734 11:59703312-59703334 ATGGAGCAGTGGAGGAAAGTGGG - Intergenic
1083161743 11:60858683-60858705 AGGGAGCAAAGGAATGAAGGAGG + Intergenic
1085468582 11:76741328-76741350 ATGGAGGAGCTGTATGAATTAGG - Intergenic
1085778795 11:79390105-79390127 ACAGAGCAGTGGAATGAAGGTGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087867645 11:103251689-103251711 AGGTAGCAGGGGAATGAAGGAGG - Intronic
1089084447 11:115805264-115805286 ATGTAGCTGCAGAATGGAGTAGG - Intergenic
1090682682 11:129078062-129078084 AGGTAGCAGAGGAATGAAGTGGG - Intronic
1091975158 12:4818542-4818564 CTGCAGCAGTGAAATGAAGTAGG + Intronic
1095986201 12:48001440-48001462 CTGGAGCAGTGGAATGCAGGCGG + Intronic
1096523758 12:52198694-52198716 ATTGAGCAGCCGGAGGAAGTAGG - Intergenic
1098229338 12:68357111-68357133 ATGGAACAGATGAATGAAGTAGG - Intergenic
1099913029 12:88856708-88856730 ATGGATCAGCTGACTGAAGCTGG + Intergenic
1100850458 12:98704703-98704725 ATGAAACAGCGGGAAGAAGTAGG + Intronic
1101922552 12:108944549-108944571 ATTGGGCAGCTGCATGAAGTGGG + Intronic
1103333292 12:120169953-120169975 CTGGAGCAACAGAATGAAGGAGG + Intronic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1108265829 13:48707710-48707732 ATAGAGCAGAGGATTGAAGCAGG - Exonic
1116229316 14:42195809-42195831 ATGAAGCAGAGGCATGAAATAGG + Intergenic
1117774523 14:59169087-59169109 ATGAAGGAGAAGAATGAAGTTGG + Intergenic
1117784491 14:59268355-59268377 ATGTAGGAGCGGAATTAACTGGG + Intronic
1120748164 14:88171544-88171566 AAGGATCAGTGAAATGAAGTTGG + Intergenic
1121612774 14:95292938-95292960 ACGGAGCAGGAGAAAGAAGTGGG + Intronic
1122121144 14:99554133-99554155 ATGGGGCAGGGGACTGAAGCTGG - Intronic
1127879598 15:63145023-63145045 ACAGAGCAGCGGATGGAAGTTGG - Intronic
1129318777 15:74762459-74762481 GGGGAGCAGTGGAAGGAAGTGGG - Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1131833808 15:96370531-96370553 ATGGAGCAGTGCAGTGAGGTGGG - Intergenic
1132247033 15:100305579-100305601 ATGGCCCAGCAGAATGGAGTAGG - Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1139761670 16:69188789-69188811 AGGGAGGAAAGGAATGAAGTTGG + Intronic
1139902863 16:70341926-70341948 ATGGAGCAGGTGAGTTAAGTAGG - Intronic
1143022853 17:3925646-3925668 ATGGAACAGTGGAGTGAAGGAGG - Intronic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1147330211 17:39694800-39694822 GTGGATCAGTGGAATGAAGCGGG + Intronic
1148241997 17:46005729-46005751 CTGGAGCTGCGGAAGGAGGTGGG - Intronic
1150379247 17:64707757-64707779 CTGGACCAGCTCAATGAAGTAGG - Intergenic
1153333770 18:3901082-3901104 AGGGAGCAGCAGAAGGGAGTAGG - Intronic
1157633842 18:49129684-49129706 ATGGAGCAGGCGACTGAAGAGGG + Intronic
1157703241 18:49778940-49778962 AGGTAGCAGGGGAGTGAAGTGGG + Intergenic
1160016090 18:75141797-75141819 ATGGAGCGGAGGACTGAAGCGGG - Intergenic
1161390640 19:4018685-4018707 AAGGAGCAGCAGAGTGATGTAGG + Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161769137 19:6222036-6222058 CTGGAACAGCGGAAGGAGGTGGG - Intronic
1162989546 19:14293500-14293522 AAGGGGCTGCGGAATGAGGTTGG + Intergenic
1163244755 19:16086558-16086580 ATGGCGCAGCAGCAGGAAGTGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166147766 19:40849179-40849201 ATGGAGGAAGGGAAGGAAGTGGG + Intronic
1166178266 19:41089695-41089717 ATGGAGGAAGGGAAGGAAGTGGG - Intronic
1166661084 19:44647704-44647726 AGGGGGCAGCGCAATGATGTGGG + Intronic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167591536 19:50406911-50406933 GTGGAGCAGGAGAAGGAAGTGGG - Intronic
1167714214 19:51130792-51130814 ATGGAGGAGTGGACTGAAGTGGG - Intronic
925080702 2:1062368-1062390 TGGGAGCAGAGGAATGAAGTGGG + Intronic
925465813 2:4106612-4106634 ATGGAGCAGGTGATTGATGTAGG + Intergenic
925826917 2:7858491-7858513 ATGGGGCACAGGAATGGAGTGGG - Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
937514465 2:122637864-122637886 ATGGGGCAGTGGAGTGAAGAGGG + Intergenic
937811466 2:126204059-126204081 ATGGTGGAGGGGAAGGAAGTGGG + Intergenic
941738294 2:169005049-169005071 AGGCAGCAGGGGAGTGAAGTGGG + Intronic
943793682 2:191965238-191965260 AAGAAGCAGGGGAAGGAAGTGGG - Intronic
945253053 2:207780415-207780437 ATGGAGCAGTGGATTTTAGTTGG + Intergenic
946016750 2:216610190-216610212 TTGGGGCAGAGGAATGGAGTAGG - Intergenic
946109493 2:217402013-217402035 TTGGAGCAGCGGTGAGAAGTTGG + Intronic
1168772068 20:421705-421727 CTGGAGCAGAGGGATGAAGGGGG + Intronic
1169820350 20:9703353-9703375 ATGGTGCACCTGAATGCAGTTGG + Intronic
1169825464 20:9763591-9763613 ATTAAGCAACAGAATGAAGTTGG + Intronic
1170461355 20:16579606-16579628 ATGGAGGAGAGGAGGGAAGTAGG - Intergenic
1170716988 20:18840384-18840406 CTGGAGGAGAGGAATGGAGTGGG - Intergenic
1171503127 20:25610173-25610195 AAGGAGCAGCTGAATTAAGGAGG + Intergenic
1175554657 20:59840977-59840999 ATGGAGCAGCACAACGAAGAAGG - Intronic
1177581804 21:23033108-23033130 ATGGTGCAGAAGATTGAAGTTGG - Intergenic
1178261500 21:31104271-31104293 ATGCTGCAGCGGAGTGCAGTGGG - Intergenic
1179443389 21:41411793-41411815 AGGTAGCAGGGGAGTGAAGTGGG - Intergenic
1181310396 22:21941582-21941604 ATGGAGCTGCGGAATGAATGAGG + Intronic
1181455298 22:23056125-23056147 CTGGAGCAGGTGAATGAAGGGGG + Intergenic
1183148681 22:36019289-36019311 GTGGAGGAGTGGAATGAACTGGG - Intronic
1183334300 22:37237852-37237874 AAGGAGCAGCAAGATGAAGTCGG + Intronic
1183358224 22:37370572-37370594 ATGGAGGAGGGGAAGGAACTGGG + Exonic
1184614746 22:45630472-45630494 AGGAAGCAGGGGGATGAAGTGGG + Intergenic
949479068 3:4476184-4476206 ATGGAGCACTGTTATGAAGTAGG - Intergenic
951505128 3:23436312-23436334 ATGGAACAGCAGAATGAACCTGG - Intronic
953276768 3:41508564-41508586 AGGTAGCAGGGGAGTGAAGTGGG - Intronic
955086236 3:55705675-55705697 ATGGATCAGCTGAATGAATTTGG - Intronic
956839297 3:73122064-73122086 ATGGAGCTGAGGTAGGAAGTGGG - Intergenic
957911174 3:86621527-86621549 ATGAAGCAGCAGAAGGAAATAGG + Intergenic
960373724 3:116872701-116872723 ATGAAGCAGGAGAAAGAAGTCGG + Intronic
961947704 3:130711440-130711462 GTGGAGCAGAGAAATGAAGGAGG + Intronic
962099972 3:132331653-132331675 ATGGAGCAGCATTATGAACTTGG + Exonic
964078087 3:152716405-152716427 ATGGAGCAGAGCAATGTAGGGGG - Intergenic
965073630 3:163948388-163948410 TTGGAGCAACAAAATGAAGTAGG + Intergenic
975621877 4:76304950-76304972 ATGGAGCAGGGGAAGGATATAGG + Intronic
975704195 4:77095640-77095662 ATGGGGGAGTGGAATGAAGTGGG + Intergenic
976299975 4:83508031-83508053 AGGGAGCAGAAAAATGAAGTGGG + Intronic
976502336 4:85806049-85806071 ATGAAGCAGCTGAATGGGGTAGG - Intronic
978603994 4:110459249-110459271 ATGGAGAAACGGAAGGAACTAGG + Intronic
979153926 4:117358112-117358134 ATGCAGCAGGGGAATGATCTAGG - Intergenic
979342933 4:119549277-119549299 TTGGAGCATTGGAATGATGTAGG + Intronic
979345674 4:119584135-119584157 CTGGAGCAGGAGAAAGAAGTAGG + Intronic
982712658 4:158772508-158772530 TTGGAGCAGTTAAATGAAGTAGG + Intronic
988002279 5:25363487-25363509 AGGTAGCAGAAGAATGAAGTGGG - Intergenic
992266948 5:75028838-75028860 ATGGAGCTGCAGAATTAAGGTGG - Exonic
993026279 5:82650799-82650821 AAGGAGCAGGACAATGAAGTAGG - Intergenic
997866843 5:137471426-137471448 TTGCAGCAACTGAATGAAGTAGG - Intronic
999381037 5:151121699-151121721 ATGGAGCCGCTGGAGGAAGTGGG - Intronic
1000211885 5:159114982-159115004 ATAGGGCAGTGGAATGAAGGAGG - Intergenic
1001400730 5:171444997-171445019 ATGGAGCAGGGGAATGGGGTAGG + Intronic
1003861239 6:10323742-10323764 ATGCAGCAGCGAAATGGAGCTGG + Intergenic
1004025388 6:11813294-11813316 AAAGAACAGCAGAATGAAGTCGG + Intergenic
1007994240 6:46289169-46289191 ATGTAGGAGAGGAAGGAAGTTGG - Intronic
1010183274 6:73112768-73112790 ATGGAGCTGGGGAAAGAAGGGGG + Intronic
1016390042 6:143565645-143565667 ATGGAGCAGGGGCATTAGGTGGG + Intronic
1021110250 7:16685820-16685842 ATGAAGCAAAGGACTGAAGTGGG - Intronic
1027648984 7:80841025-80841047 ATCAAGAAGCGGAATGGAGTGGG + Intronic
1029423678 7:100484153-100484175 ATGGAGAAGGGGGATGAAGCAGG + Intronic
1030371066 7:108699839-108699861 ATGGAAGAGAGTAATGAAGTTGG - Intergenic
1031699370 7:124904287-124904309 ATCCAGCAGCAGAATCAAGTTGG + Intronic
1031796848 7:126185934-126185956 AAGTAGCAGGGGAGTGAAGTGGG + Intergenic
1034001952 7:147424113-147424135 ATGGAGCAGCGGAATGAAGTAGG - Intronic
1035120870 7:156565504-156565526 AAGGAGCAAAGGAAGGAAGTGGG + Intergenic
1036612983 8:10366000-10366022 AAGGAGCAGGGGAATGAGGCAGG - Intronic
1037073042 8:14676051-14676073 AACTAGCAGAGGAATGAAGTGGG + Intronic
1037921599 8:22810204-22810226 CAGCAGCAGCGGAAGGAAGTAGG - Intronic
1038288554 8:26227814-26227836 ATGAGGCAGCGGAGTTAAGTTGG - Intergenic
1039715788 8:40107288-40107310 ATGGAGCAGCTGAATTTAATGGG - Intergenic
1043602778 8:81961207-81961229 ATGGAACAGCCTTATGAAGTAGG + Intergenic
1044837754 8:96312833-96312855 CTGGGGCAGAGGAAGGAAGTGGG - Intronic
1044941767 8:97350807-97350829 CTGAAGCAGCTGAACGAAGTAGG + Intergenic
1045364125 8:101459914-101459936 TCAGAGCAGAGGAATGAAGTGGG + Intergenic
1045778970 8:105841245-105841267 AAGGAGAAGGGGAATGAAGGAGG - Intergenic
1046744767 8:117864895-117864917 TTGGAGAAGAGGAAGGAAGTAGG - Intronic
1048386041 8:133913395-133913417 ATGGAGCCACAGACTGAAGTTGG - Intergenic
1051096133 9:13467431-13467453 ATGCAGCAACTCAATGAAGTAGG - Intergenic
1053905907 9:42844582-42844604 TTGGTGCAGTGGAATGAGGTTGG - Intergenic
1056347230 9:85709468-85709490 ATTGAGCAGCTGAATGACATTGG - Intronic
1062681532 9:137784695-137784717 AGGGAGCAGCTGAGTGAACTGGG + Intronic
1187944388 X:24412146-24412168 AAAGAGCAGGGGAATGAAGAAGG - Intergenic
1193606240 X:83570455-83570477 ATAAAGCAGCGGAAGAAAGTGGG - Intergenic
1193827431 X:86242844-86242866 ATGGAGCAGGAGAAAGAAGGGGG - Intronic
1195866666 X:109439760-109439782 ATGGAAATGAGGAATGAAGTTGG - Intronic
1196519316 X:116654643-116654665 AGGTAGCAAGGGAATGAAGTGGG + Intergenic
1198343710 X:135739700-135739722 ATGGAGCAGAGGAGGGGAGTGGG - Intergenic
1199799873 X:151239937-151239959 ATCCAGCTGTGGAATGAAGTCGG - Intergenic
1201859763 Y:18584185-18584207 ATGGAACAGCGACTTGAAGTAGG - Intronic
1201873558 Y:18736196-18736218 ATGGAACAGCGACTTGAAGTAGG + Intronic
1202377419 Y:24250262-24250284 ATGGAGCAGAGGATGGAGGTGGG - Intergenic
1202493361 Y:25419859-25419881 ATGGAGCAGAGGATGGAGGTGGG + Intergenic