ID: 1034002601

View in Genome Browser
Species Human (GRCh38)
Location 7:147432248-147432270
Sequence GGGGTGCTATGCCATCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 1, 2: 5, 3: 11, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034002601_1034002609 28 Left 1034002601 7:147432248-147432270 CCCACTAGATGGCATAGCACCCC 0: 1
1: 1
2: 5
3: 11
4: 79
Right 1034002609 7:147432299-147432321 AGACATTGCCAAATAGCTCTTGG 0: 1
1: 1
2: 55
3: 220
4: 948
1034002601_1034002610 29 Left 1034002601 7:147432248-147432270 CCCACTAGATGGCATAGCACCCC 0: 1
1: 1
2: 5
3: 11
4: 79
Right 1034002610 7:147432300-147432322 GACATTGCCAAATAGCTCTTGGG 0: 1
1: 1
2: 34
3: 187
4: 727

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034002601 Original CRISPR GGGGTGCTATGCCATCTAGT GGG (reversed) Intronic
903508422 1:23854747-23854769 GGGGTGGTATGCCATCTAGTGGG + Intronic
904994211 1:34618301-34618323 GGGTTGCACTGGCATCTAGTGGG + Intergenic
907596090 1:55721274-55721296 GGAGTGCTATGGCATCTGGTGGG + Intergenic
909577116 1:77187216-77187238 GGAGAACTCTGCCATCTAGTTGG - Intronic
910033182 1:82756993-82757015 AGAGTGCTATGGCATCTAGACGG + Intergenic
912808890 1:112778555-112778577 GGAGAGTTATGCAATCTAGTGGG + Intergenic
913188011 1:116387766-116387788 GCTGTGCTCTGCCATCCAGTGGG - Intronic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
918094838 1:181325954-181325976 GGAGTGCAAGGCCGTCTAGTTGG - Intergenic
922177865 1:223211134-223211156 GGGGTACTATTGCATCTTGTGGG - Intergenic
924772237 1:247088342-247088364 TGGCTGCTATGGCATCTGGTGGG - Intergenic
1063886628 10:10586569-10586591 GGGAAGCTATGCCGTGTAGTGGG + Intergenic
1065060205 10:21892821-21892843 GGATTGCTATGCCATCTTGGTGG - Intronic
1068011729 10:51460117-51460139 GGGGTCCTCTGGCATTTAGTGGG - Intronic
1072663335 10:97376689-97376711 TGGGTGCTCTGGCATCTAGTGGG - Intronic
1074729861 10:116359553-116359575 AGGGTGCTACTGCATCTAGTGGG - Intronic
1075638937 10:124050526-124050548 GGGGTGCTATGGCATCCAGTGGG - Intronic
1075653850 10:124148133-124148155 AGGATGCTATGGCATCTAGGAGG - Intergenic
1081360760 11:42174977-42174999 GTGGTGCTATGCCATATGGGAGG - Intergenic
1087749272 11:101989383-101989405 GAAGTGCTGTGGCATCTAGTGGG - Intronic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1091715837 12:2775555-2775577 GGGGTGCTGTTCCAGCTGGTGGG - Intergenic
1094042359 12:26131582-26131604 GGAGGGCTATGCTATCCAGTTGG + Intronic
1095906382 12:47382478-47382500 AGGATGCTACCCCATCTAGTGGG + Intergenic
1098349096 12:69538938-69538960 GGGGTGTCATGGCATCTAGGAGG - Intronic
1101549773 12:105751081-105751103 AGGGTGCTATGCTAACTAGCTGG + Intergenic
1104576537 12:129971862-129971884 GAGGTGCTATGGCACCTAGTGGG - Intergenic
1104582537 12:130021735-130021757 AGGTTGCTATGGCATCTAATGGG + Intergenic
1106389587 13:29322333-29322355 GGGGAGCTTAGCCATATAGTGGG + Intronic
1116531324 14:45977255-45977277 GGGGTGATAAGCCAGCTACTTGG - Intergenic
1117666049 14:58057005-58057027 GTTGTGCTCTGCCACCTAGTAGG - Intronic
1120257184 14:82135297-82135319 AGTGTGGTATACCATCTAGTGGG + Intergenic
1122337331 14:101002436-101002458 GGCGTGCCATGCCATCTTGAAGG - Intergenic
1123410939 15:20058519-20058541 GAGGAGCGATGCCGTCTAGTTGG - Intergenic
1123520269 15:21065207-21065229 GAGGAGCGATGCCGTCTAGTTGG - Intergenic
1128570181 15:68728049-68728071 GGGTTGCTATGGCATCTGATTGG - Intergenic
1130366976 15:83249482-83249504 GGGGTGCTATGGCATTTAGTGGG + Intergenic
1132646762 16:1002798-1002820 GGGGTGCTGTGGCATCCAGCGGG - Intergenic
1133905278 16:10016563-10016585 GGGATGCTATGCCAGATAGGAGG - Intronic
1134083682 16:11341936-11341958 AGGGTGCCATGGCATCTCGTGGG + Intronic
1144473241 17:15563071-15563093 GGGGTGCGATGCTATCTTGTAGG - Intronic
1144923241 17:18781649-18781671 GGGGTGCGATGCTATTTTGTAGG + Intronic
1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG + Intergenic
1152855930 17:82664427-82664449 GGGGTGCTATGCCAGCCAGGGGG + Intronic
1153406894 18:4750848-4750870 GTGGTTCTATGCCATTTTGTTGG + Intergenic
1155023448 18:21917998-21918020 GGGGAGCTATGCCATCCTCTTGG - Intergenic
1157894923 18:51456936-51456958 GGGGTACTAGCCCATCTAGAAGG - Intergenic
1163787029 19:19279995-19280017 GGGGTGGCATGCCACCTACTGGG + Intronic
1164259899 19:23560447-23560469 GGGGTACTATGCCATATTGCTGG - Intronic
927666875 2:25039021-25039043 GGTGTGCAAGCCCATCTAGTGGG + Intergenic
935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG + Intronic
946862691 2:224015023-224015045 GTGGTGCCATGGCATCTGGTAGG + Intronic
1171144042 20:22766397-22766419 CTGGTGCTTTGCCATCTACTTGG - Intergenic
1172489435 20:35323395-35323417 GGGATGCTATTACATCTACTTGG - Intronic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1175394343 20:58648643-58648665 GGGCTGCTATGCCAACTTCTTGG + Intergenic
1179086568 21:38223451-38223473 GGGATGCTGTGAAATCTAGTTGG + Intronic
1180606810 22:17065157-17065179 GGGGTGGTATTCCAGCCAGTGGG - Intergenic
1183523295 22:38309087-38309109 GGGGTGCCCTGGCATCTAGTGGG - Intronic
959902447 3:111675343-111675365 GGGGAGCGAGGCCATCCAGTCGG - Exonic
960984631 3:123268035-123268057 GGGATTCATTGCCATCTAGTGGG + Intronic
963830801 3:150006894-150006916 GGGCTGCTATGCCATGGACTGGG - Intronic
969399719 4:6946173-6946195 TAGGTGCTATGCCATGTACTGGG - Intronic
971536959 4:27765078-27765100 GTGGTGTTATGACATCCAGTTGG + Intergenic
977564081 4:98563850-98563872 AGGGTGCACTGGCATCTAGTGGG + Intronic
992400384 5:76405377-76405399 GGGGTGGTGTGCCATCTTGTTGG + Intronic
996776074 5:127134219-127134241 GGGGGGCCAGGACATCTAGTGGG - Intergenic
997386147 5:133474355-133474377 GGGGTGCTGTGCTCTCTAGCTGG - Intronic
999351514 5:150875814-150875836 GGGGTGATCAGCCAGCTAGTTGG + Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1011264668 6:85502787-85502809 GTTGTGCTATGACATTTAGTTGG + Intergenic
1013238077 6:108216329-108216351 GGGGTGCTATGTTGTCTAGTGGG - Intronic
1021917973 7:25454841-25454863 TGAGTGTTATGGCATCTAGTGGG - Intergenic
1026885944 7:73945348-73945370 GGAATGCTATGTCATCTGGTAGG + Intergenic
1028439998 7:90848815-90848837 AGGTTCCTATTCCATCTAGTGGG + Intronic
1030465152 7:109891937-109891959 AGTGGGCTATACCATCTAGTAGG - Intergenic
1034002601 7:147432248-147432270 GGGGTGCTATGCCATCTAGTGGG - Intronic
1034011526 7:147534189-147534211 GGGTTGCTATGGTATCTAATGGG + Intronic
1038122847 8:24637543-24637565 GGGGTGATATACCCTCCAGTGGG - Intergenic
1044963521 8:97554187-97554209 AGGGTGCCATGGCATGTAGTGGG - Intergenic
1050519193 9:6479435-6479457 GGGGTGCTCTGAAATCTGGTAGG - Intronic
1053086897 9:35232628-35232650 TGGGTGGTATGCCATTCAGTAGG + Intronic
1055790120 9:79914686-79914708 GGGGTCCTATAAGATCTAGTAGG + Intergenic
1060872088 9:127050704-127050726 GGAATGCTATGCCATCCCGTGGG + Intronic
1062694210 9:137864852-137864874 GGAGTGCTATGGCACTTAGTGGG + Intronic
1186135547 X:6516438-6516460 GTGGGGCTAGGCCATTTAGTAGG + Intergenic
1186323399 X:8453404-8453426 GGGGTGGATTGGCATCTAGTGGG - Intergenic
1186431626 X:9510132-9510154 GGGGTGCTATGGCATTGGGTGGG + Intronic
1186525276 X:10242597-10242619 GGGGTGCGATGGCATCTAGTGGG - Intergenic
1186744532 X:12553642-12553664 GGTGTTTTATGCCATCTAGCAGG - Intronic
1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG + Intronic
1195815536 X:108881831-108881853 GGATTGCTATGCCTTCTTGTTGG - Intergenic
1195996610 X:110737944-110737966 AGGGTACTCTGGCATCTAGTGGG + Intronic
1202268000 Y:23041056-23041078 GGGGTGTTGTGCCATACAGTTGG + Intergenic
1202420992 Y:24674800-24674822 GGGGTGTTGTGCCATACAGTTGG + Intergenic
1202449794 Y:24995282-24995304 GGGGTGTTGTGCCATACAGTTGG - Intergenic