ID: 1034003002

View in Genome Browser
Species Human (GRCh38)
Location 7:147437153-147437175
Sequence ATCAGCAATCCCTCTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034003002_1034003006 20 Left 1034003002 7:147437153-147437175 CCAACACCAGAGGGATTGCTGAT 0: 1
1: 0
2: 2
3: 9
4: 87
Right 1034003006 7:147437196-147437218 CTACATTTATGATAATGAGGTGG 0: 1
1: 0
2: 2
3: 14
4: 162
1034003002_1034003004 17 Left 1034003002 7:147437153-147437175 CCAACACCAGAGGGATTGCTGAT 0: 1
1: 0
2: 2
3: 9
4: 87
Right 1034003004 7:147437193-147437215 TTCCTACATTTATGATAATGAGG 0: 1
1: 0
2: 0
3: 21
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034003002 Original CRISPR ATCAGCAATCCCTCTGGTGT TGG (reversed) Intronic
901043154 1:6378266-6378288 ATCAGCATGCCCTCTGCTGGTGG + Intronic
902549088 1:17208599-17208621 GTGAGCTAGCCCTCTGGTGTGGG - Intronic
918682441 1:187372133-187372155 AGCAACACTCACTCTGGTGTTGG - Intergenic
918741846 1:188141960-188141982 ACCAGCAACTCCTCTGTTGTGGG + Intergenic
919608040 1:199710473-199710495 ATCAGCAATGCTTCTGGGATTGG + Intergenic
922316677 1:224448715-224448737 TACAGAAGTCCCTCTGGTGTGGG - Intronic
1064372209 10:14762391-14762413 ATTCGCAAACCCTCTGGTTTAGG - Intronic
1069216658 10:65829815-65829837 ATCAGTAATCATTTTGGTGTGGG - Intergenic
1069716551 10:70524775-70524797 TTCAGCAAATCCTCTGCTGTGGG + Intronic
1072742720 10:97919609-97919631 GTCACCAATGCCACTGGTGTAGG - Intronic
1077590623 11:3488224-3488246 ATAAGCAATTGCTCTGGTTTTGG + Intergenic
1081963054 11:47152357-47152379 ATCAGCAGTCCCTTTGGAGATGG - Intronic
1084919254 11:72455930-72455952 CTCAGCAAACCCCATGGTGTGGG - Intergenic
1088797943 11:113279862-113279884 ATCAGCAATGCTTCAGGTGGTGG + Intergenic
1089739979 11:120575758-120575780 AGCAGAAAGCCCCCTGGTGTTGG + Intronic
1093818908 12:23586962-23586984 ATCAGCATTTCTTTTGGTGTAGG - Intronic
1095635857 12:44432818-44432840 ATCAGCATTCCCTTGGGTGCTGG + Intergenic
1099450289 12:82799787-82799809 ATCGGCAAGACCTCTGTTGTAGG - Intronic
1101164140 12:102010594-102010616 ATCAGAAATTCCGCTGGTCTAGG - Intronic
1104332704 12:127862309-127862331 TTCAGCCAGCCCTTTGGTGTAGG + Intergenic
1106628189 13:31442307-31442329 ATCTGCACTCCCTCTGGGATCGG - Intergenic
1108345281 13:49539756-49539778 ATCATCATTCCATCTGTTGTCGG + Intronic
1108617702 13:52150299-52150321 CTTAGTAATCCCTCTGTTGTTGG - Intronic
1110750103 13:79103569-79103591 AACTGCTATCCCTGTGGTGTTGG + Intergenic
1113705617 13:112430973-112430995 GGCAGTAATCTCTCTGGTGTAGG + Intronic
1114777803 14:25504910-25504932 CCCAGCAGTCCCTCTGGTGGAGG + Intergenic
1117424702 14:55581161-55581183 CTCAGCCATACGTCTGGTGTGGG + Intronic
1117606083 14:57430706-57430728 ATCAGAAATCCCCCTGGCTTGGG - Intergenic
1122604216 14:102937754-102937776 ATCAGCAGTCTCTTTGGTCTGGG - Intronic
1134131703 16:11654700-11654722 ATCAAGAATGGCTCTGGTGTCGG + Intergenic
1134771809 16:16815622-16815644 AAGAGCAATCCTTCTGCTGTTGG + Intergenic
1134895841 16:17886154-17886176 TTCAGCAAACCCTGGGGTGTAGG - Intergenic
1138016388 16:53432771-53432793 ATCAGCAATGCTTTTGGAGTTGG - Intergenic
1143700966 17:8659809-8659831 ACCAGCTATCCCTCTGTTGTGGG + Intergenic
1149662006 17:58338934-58338956 TTCAGGAATCCCTCTGGCCTTGG - Intergenic
1150921843 17:69492297-69492319 ATCTTTAATCCCTCTGGAGTTGG + Intronic
1156075672 18:33275814-33275836 AACAGAAATCCCTCTGTTTTAGG - Intronic
1161489800 19:4555635-4555657 ATCAGGATTCCCCCTGGAGTGGG - Intronic
1162869699 19:13576162-13576184 ATCAGCAAGACAGCTGGTGTTGG - Intronic
925634862 2:5933330-5933352 ACCAGGAAGCCCTGTGGTGTTGG + Intergenic
928587701 2:32778056-32778078 AACAGCAATTCCTTTTGTGTTGG + Intronic
934861472 2:97766990-97767012 TTCAGGAATCCCACTGGTGGTGG - Intronic
940706264 2:157108319-157108341 ATCAGCAATCCCTCTGATGGGGG - Intergenic
940913681 2:159230665-159230687 GTCAGCAGCCCCTCTGGTGCCGG - Exonic
946105437 2:217365273-217365295 AACTACCATCCCTCTGGTGTGGG - Intronic
948087849 2:235266174-235266196 CTCAGCAATCTCTCTGCTCTGGG - Intergenic
948641955 2:239380804-239380826 AGCAGCAATGCCTCTGAAGTTGG - Intronic
1172293645 20:33793018-33793040 ATCAGAAATCCCTCTCGTGTCGG + Intergenic
1174830022 20:53803993-53804015 TCCAGCAAACCCTCTGGTGCAGG + Intergenic
1175185268 20:57175724-57175746 AAAAGCAATCCCTCTGTTGTGGG - Intronic
1175506760 20:59491663-59491685 ATCAGCCATCCCAGTGTTGTTGG - Intergenic
1179834125 21:44017876-44017898 AACAGCAATGCTTGTGGTGTAGG - Intronic
1183588124 22:38764761-38764783 ACCAGCCATGCCTCAGGTGTGGG + Intronic
1185175075 22:49321771-49321793 ATCAGCCTTCCATCTGCTGTGGG + Intergenic
951334760 3:21406850-21406872 ATCAGCAATCCCACTACTGAGGG + Intergenic
951484457 3:23196219-23196241 ATCAGCATTCCCCCTTGTATTGG - Intergenic
953072653 3:39537312-39537334 ATCTGTAATCCCTGTGGTCTGGG - Intergenic
964615421 3:158659082-158659104 ATTAGAAATTCCTCTGATGTGGG + Intronic
984174765 4:176403651-176403673 ATCAGCAATCCCTGAGAAGTGGG - Intergenic
988600819 5:32638214-32638236 ATAAGTAAGCCCTATGGTGTTGG - Intergenic
997604267 5:135162927-135162949 TGCAGCCATCCCTCTGGAGTTGG + Intronic
998724889 5:145000492-145000514 CCCAGCAATCCCTCTACTGTTGG - Intergenic
999177266 5:149640177-149640199 ATCAGTAGAGCCTCTGGTGTGGG + Intergenic
1001907962 5:175488597-175488619 GTCAGAAATGCATCTGGTGTCGG - Intronic
1004285282 6:14315725-14315747 CTCAGTAATCCCTGTGGTGGGGG + Intergenic
1006205085 6:32333623-32333645 AACAGCTATCCCTCTGCTGTGGG - Intronic
1009779752 6:68255346-68255368 ATCAGCACTTGCTCTGGTGGAGG + Intergenic
1012324076 6:97892311-97892333 ATCAGAAATCCTGCTGGTGAGGG - Intergenic
1013270794 6:108543859-108543881 ATCATTAATCCCTTTGCTGTGGG - Intergenic
1013355733 6:109344374-109344396 CCCAGCAATCCCTGTGGTGTGGG - Intergenic
1014172008 6:118288956-118288978 ATGAGCAATCCCTGTGCTGATGG - Intronic
1014863937 6:126505453-126505475 ATAAGCAATCCCTGTGGTGAGGG + Intergenic
1017010611 6:150060868-150060890 ATCAGCTCTTCCTCTGGTCTGGG - Intergenic
1021132938 7:16933277-16933299 ATCAGCAAAGGCTCTGCTGTGGG + Intergenic
1021492341 7:21232727-21232749 ATCACCATTCTCACTGGTGTGGG + Intergenic
1021671044 7:23035392-23035414 ATCACCATTCTCACTGGTGTGGG - Intergenic
1023258038 7:38331128-38331150 ATCTGCACTCCCTCTGCTGCAGG - Intergenic
1023258552 7:38335841-38335863 ATCTGCACTCCCTCTGCTGGAGG - Intergenic
1023259206 7:38341496-38341518 ATCTGCACTCCCTCTGCTGGAGG - Intergenic
1023259684 7:38345825-38345847 ATCTGCAGTCCCTCTGCTGGAGG - Intergenic
1023260614 7:38354516-38354538 ATCTGCATTCCCTCTGCTGCAGG - Intergenic
1023262088 7:38368383-38368405 ATCTGCACTCCCTCTGCTGTGGG - Intergenic
1029199785 7:98831211-98831233 AGCAGCTATCACTATGGTGTTGG + Intergenic
1032072648 7:128818320-128818342 ATAAGGAATCCCTCTTCTGTTGG + Intronic
1033639334 7:143246129-143246151 ATAAGCACTCCATCTGATGTGGG - Intronic
1033886448 7:145953557-145953579 ATGAGGAATCTCTGTGGTGTTGG - Intergenic
1034003002 7:147437153-147437175 ATCAGCAATCCCTCTGGTGTTGG - Intronic
1040408672 8:47133712-47133734 AACAGCAAGCGCTTTGGTGTGGG + Intergenic
1041975632 8:63796034-63796056 ATCAGCACTCCTTCCGGTGTGGG + Intergenic
1042436979 8:68777231-68777253 ATCAGCTATCCCTCTTGTGGAGG - Intronic
1047263739 8:123285949-123285971 ATGAGAAAACCCTCAGGTGTAGG + Intergenic
1048497780 8:134949418-134949440 ATCAGCCATCCCAGGGGTGTGGG + Intergenic
1052081333 9:24209752-24209774 ATCACCCATCCCTGTGGTGGCGG - Intergenic
1054936391 9:70693429-70693451 ATAAGAAATCCATATGGTGTTGG - Intronic
1186397875 X:9228123-9228145 ATCAGCAATCCATGTGGCTTAGG - Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1193728070 X:85066866-85066888 ATCATCAATTCCTTTTGTGTAGG + Intronic
1196347753 X:114685588-114685610 ATTGACAATCCCTCTGGTGGCGG - Intronic
1196727745 X:118912382-118912404 ATGAGCAACCCCTCTAGTGTAGG + Intergenic