ID: 1034004105

View in Genome Browser
Species Human (GRCh38)
Location 7:147450018-147450040
Sequence CAGGACAGGACACCCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034004105 Original CRISPR CAGGACAGGACACCCTTGGT TGG (reversed) Intronic
900409839 1:2507536-2507558 CAGGACACGAGACCCTTTGGTGG + Intergenic
900521004 1:3105484-3105506 CAGGAAAGGGAACCCTTGGACGG + Intronic
900673239 1:3868776-3868798 TAGGACAGGACACCCATTGCAGG - Intronic
902542790 1:17166453-17166475 CAGGACTGGAACCCCATGGTGGG + Intergenic
902653244 1:17850635-17850657 CAGGGCAGGACACCACTGGGAGG - Intergenic
904557469 1:31374573-31374595 CAGGACAGGACTCCCTTTAGAGG - Intronic
908429895 1:64046257-64046279 CTGGACTGGACACCTTTGCTGGG + Intronic
912608725 1:111020536-111020558 CAGGACATGAAATTCTTGGTTGG - Intergenic
914827898 1:151148659-151148681 AAGGACAGGAAAACTTTGGTGGG + Intergenic
914839944 1:151240104-151240126 GAGGGCAGGACACCTCTGGTAGG + Intronic
914922807 1:151859088-151859110 GAGGGCAGGGCAGCCTTGGTGGG - Intergenic
915368835 1:155331031-155331053 GAAGCCTGGACACCCTTGGTGGG + Exonic
915960183 1:160259908-160259930 CTGAACATGAAACCCTTGGTGGG - Intronic
918127528 1:181597435-181597457 CAGGACAAAACACACTTCGTTGG + Intronic
920493560 1:206437961-206437983 CAGGAGAGGACCCCCTGGCTGGG + Exonic
920544981 1:206808893-206808915 CAGGAAAGGACAGCCTGGGTGGG + Intronic
922015946 1:221647130-221647152 CAGGACAGGGCCCCCATGATGGG - Intergenic
923065675 1:230515118-230515140 CAAGAGAGGCCACCCTTGCTGGG + Intergenic
1065019775 10:21494787-21494809 CAGGTCAGGACCCACTAGGTGGG + Exonic
1067090775 10:43264943-43264965 CAGGATGGGACAGCTTTGGTTGG - Intronic
1071600159 10:86955078-86955100 GGGGACAGGACAGCCTGGGTGGG + Intronic
1071684175 10:87737141-87737163 AAGGCAAGGAGACCCTTGGTGGG - Intronic
1073147763 10:101291887-101291909 CAGGACAGGACAGTCTTCGTAGG - Intergenic
1074904909 10:117853039-117853061 GTGGACAGGACAGCCTGGGTAGG + Intergenic
1075319611 10:121480183-121480205 CAGGACAGGAGACCCCTAGAAGG + Intronic
1076562299 10:131375169-131375191 CAGGACAGAGCATCCATGGTGGG - Intergenic
1076608304 10:131703668-131703690 CAAGGCACGACACCCCTGGTTGG - Intergenic
1076662451 10:132064657-132064679 CAGGACATGTGACCCTTGGAGGG + Intergenic
1077146723 11:1049853-1049875 CAGAAGAGGACATCCTTGCTGGG - Intergenic
1077630167 11:3806228-3806250 CAGGAGCAGACACCCCTGGTTGG + Intronic
1078989398 11:16631356-16631378 CAGGACATGAAATTCTTGGTTGG + Intronic
1080344667 11:31311179-31311201 CAGGATAGGACACCCCTGTTGGG + Intronic
1081178016 11:39952991-39953013 CAGGACTGAACACATTTGGTGGG - Intergenic
1084558018 11:69886547-69886569 CTGGACAGGACAGCCGGGGTGGG + Intergenic
1084582453 11:70032451-70032473 CTGGAGAGGACTCCCTGGGTGGG + Intergenic
1085391310 11:76183691-76183713 CAGGACAGGAGACCCTGGGGGGG - Intergenic
1085869551 11:80333195-80333217 CAGGAAGGAACACCCTTGTTAGG + Intergenic
1090044031 11:123315368-123315390 CGGGACAGGAAAGCCTTGGAGGG - Intergenic
1097179097 12:57160779-57160801 CAGGACAGGAGACCCCTGTGAGG + Intronic
1097994949 12:65878025-65878047 CAGGACACCTCACCCTTGGCTGG - Intronic
1100649858 12:96573436-96573458 CAGAACAGGACTCCCTTGAAGGG - Intronic
1102471865 12:113163837-113163859 CACGACATGACACCCTCAGTGGG - Intronic
1104255201 12:127130122-127130144 CAGGACTGGCCATCCTTGGTTGG - Intergenic
1104439872 12:128785833-128785855 CAGGGCAGGACACCTTGGGTTGG + Intergenic
1104809931 12:131613967-131613989 GAGGACAGAACACGCTGGGTCGG - Intergenic
1105899169 13:24741616-24741638 GAGGAGAGGACCCCCTTGCTGGG + Intergenic
1106555348 13:30804110-30804132 CAGGAGAGGAATCCCGTGGTGGG - Intergenic
1113962878 13:114134871-114134893 CAGGACGGGAGCCCCTTGGAAGG + Intergenic
1121333662 14:93063604-93063626 CAGGACTGCACAGCCTTGGAGGG + Intronic
1122424152 14:101596046-101596068 CTGGCCAGCACACCTTTGGTGGG - Intergenic
1124512145 15:30336521-30336543 CAGGTCAGGAGACCCATGGAGGG + Intergenic
1124730769 15:32194230-32194252 CAGGTCAGGAGACCCATGGAGGG - Intergenic
1129944420 15:79526752-79526774 CAGGACAGGACCCCTCTGTTTGG + Intergenic
1141847217 16:86619013-86619035 CAGGACAGGACAGCGCTGGCGGG + Intergenic
1142708918 17:1713103-1713125 CAGGACAGCAGCCCCTTGGTGGG - Intergenic
1142851693 17:2707637-2707659 GAGGAGAGGACCCCCTTGCTGGG - Intronic
1143965403 17:10753319-10753341 CAGTACAGGACTCCCTAGTTGGG - Intergenic
1145058251 17:19716899-19716921 CAGGACAGGGCAGCCTGGCTGGG + Intronic
1145216900 17:21059725-21059747 CAGAAAAGGACACCATTGCTGGG + Intergenic
1147484828 17:40802389-40802411 AGGGACAGGAGACACTTGGTTGG + Intergenic
1148649330 17:49238447-49238469 CAGGACAGAATTCCCCTGGTGGG - Intergenic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1151570182 17:74922036-74922058 CTGGACAGGACACCCCAGGAAGG - Intronic
1152597229 17:81243754-81243776 CAGGACTGAACCCCCTTGGCGGG + Intergenic
1152728329 17:81958489-81958511 CAGGACAGGATTCCCCTGGAAGG + Intronic
1152728369 17:81958646-81958668 CAGGACAGGATCCCCCTGGAAGG + Intronic
1153346221 18:4029455-4029477 GAGGAAAGGGAACCCTTGGTGGG - Intronic
1158534151 18:58292341-58292363 CAGGAGAGGACAACCTGGCTGGG - Intronic
1161810816 19:6470261-6470283 CTGGACAGGCCACTCTTGCTGGG - Intronic
1162537079 19:11269099-11269121 CAGGCCTGGACACCCTGTGTTGG - Intergenic
1166714858 19:44960521-44960543 AAGCACAGGACACCATTGGAGGG - Intronic
1167052046 19:47085283-47085305 CTGGAGAGGACACGCTGGGTGGG - Intronic
1168676670 19:58283415-58283437 CAGGATTGGACTCCCTTGATGGG + Intronic
925999490 2:9318964-9318986 CAGGAAAATACACCCTTGCTAGG - Intronic
927739242 2:25552653-25552675 AAGGAAAGGAAACCCTTAGTAGG - Intronic
931700986 2:64908898-64908920 AAGGAGAGGACACACGTGGTAGG + Intergenic
932363542 2:71130389-71130411 CAGGACGGGTCACCCTTTGTGGG + Exonic
934138465 2:89020549-89020571 GAGGACAGGACACACATGGGAGG + Intergenic
934230778 2:90180004-90180026 GAGGACAGGACACACATGGGAGG - Intergenic
937656315 2:124381030-124381052 CAGAACAGGACGCCATGGGTGGG + Intronic
939256487 2:139750526-139750548 CATGACGTGACACCCTTGGTGGG + Intergenic
947072672 2:226308524-226308546 CAGGACAGGAATCCCAGGGTGGG + Intergenic
947147576 2:227082333-227082355 CAAGACAGGACTACCTTGGAAGG - Intronic
948386145 2:237582246-237582268 CAGGACATGACACAGGTGGTGGG - Intronic
948889973 2:240902824-240902846 CAGGAAAAGACACCCATGGCCGG + Intergenic
1170482826 20:16784724-16784746 CTGGATAGGAAACTCTTGGTTGG + Intergenic
1170930788 20:20768163-20768185 CAGGACAGGGAACCCTTGAGCGG - Intergenic
1173868827 20:46329484-46329506 CAGGGGAGGGCACCCTTGGAGGG + Intergenic
1175544493 20:59769392-59769414 CAGGACAGGACACACAGGGATGG + Intronic
1175809916 20:61852395-61852417 CAGGACAGGTGCCCCTTGGATGG - Intronic
1176266778 20:64213476-64213498 CAGGACAGGACAGGCATGGAGGG + Intronic
1179351355 21:40614118-40614140 CAGGACAGGCCACCTTAGGCTGG - Intronic
1179965743 21:44804043-44804065 CAGGGCAGCACACCCTGGGGAGG + Intergenic
1184544564 22:45158055-45158077 CAGGATAGGCAACCCCTGGTTGG - Intergenic
951237912 3:20256364-20256386 CAGGATATGACATTCTTGGTTGG + Intergenic
952011889 3:28909075-28909097 CAAGATAGCACACCCTTTGTAGG + Intergenic
952668298 3:35935001-35935023 GAGGACAGGAAACCTCTGGTGGG + Intergenic
953664806 3:44918063-44918085 CAGTAAAGGAGACCTTTGGTGGG - Intronic
954580359 3:51699914-51699936 CAGGAAAGGAGTCCCTTGGGTGG + Intronic
957330318 3:78754982-78755004 CAAAACAAGACAACCTTGGTAGG + Intronic
962220889 3:133563897-133563919 AAGGCCAGGACACCCTTCTTAGG - Intergenic
962754923 3:138459690-138459712 CAGGCCAGCACACCCGTGGAAGG + Intronic
964680444 3:159332003-159332025 CAGGAAAGGACACCCTCAGGAGG - Intronic
965876066 3:173321974-173321996 CAGGACAGAAAACCTTTGATTGG + Intergenic
968916101 4:3497682-3497704 CTGGAGAGGACACCCAGGGTGGG + Intronic
971421235 4:26475863-26475885 CAGAATATGCCACCCTTGGTTGG - Intergenic
972123680 4:35738086-35738108 CAGGACAGGTCACTCCAGGTGGG + Intergenic
978385873 4:108175086-108175108 CAGGAAATGGCTCCCTTGGTGGG - Intergenic
986462165 5:7983510-7983532 CAGGACAGGACCCCCGAGGGCGG + Intergenic
988277955 5:29107128-29107150 CAGGATAGGTCACACTGGGTGGG + Intergenic
988414362 5:30927495-30927517 CAGAACAGGACACAGTTGGTTGG + Intergenic
988913925 5:35873742-35873764 CAAAATAGGACACCCTTGGAGGG + Intronic
992611338 5:78510662-78510684 CAGGACAGTGCCCCCTGGGTTGG - Intronic
995037900 5:107556158-107556180 CAGGTCTGGACAGCCTTGATGGG - Intronic
1000994623 5:167946264-167946286 CAGGACAGGACAAGCTGGGATGG + Intronic
1001044109 5:168358191-168358213 CCTGATAGGACACCTTTGGTAGG + Intronic
1003574252 6:7278215-7278237 CAGGACCTGACACACGTGGTAGG - Intronic
1013000284 6:106015068-106015090 CAGCAAAGGGAACCCTTGGTTGG - Intergenic
1013553554 6:111233900-111233922 CAGAACAGGAGACATTTGGTTGG - Intergenic
1019316758 7:390516-390538 AAGGAGAGGACCCCCTTGCTGGG - Intergenic
1019320201 7:411775-411797 CAGGAGAGGCTACCCTGGGTGGG - Intergenic
1019917452 7:4143027-4143049 CAGAACAGGACTCCCTGGGTCGG - Intronic
1022106687 7:27201837-27201859 AAGGAAAGGGCACACTTGGTGGG - Intergenic
1028657948 7:93232334-93232356 AAAGACAGGATACCCTGGGTCGG + Exonic
1031884109 7:127227887-127227909 CTGGCCAGCACACCCATGGTGGG - Intronic
1034004105 7:147450018-147450040 CAGGACAGGACACCCTTGGTTGG - Intronic
1039613466 8:38937077-38937099 GAGGAGAGGCCACCCTTGGCTGG + Intronic
1040999140 8:53432713-53432735 AAGGGCAGGACACTCTTGGCTGG - Intergenic
1043516195 8:80996972-80996994 CAGGACAGCACTGCCTTGGGTGG - Intronic
1043516202 8:80997029-80997051 CAGGACAGCACTGCCTTGGGTGG - Intronic
1045822895 8:106362008-106362030 CAGGATAGGATACACTTGGCAGG + Intronic
1047566021 8:126045202-126045224 CAGGACATGATATTCTTGGTTGG + Intergenic
1049278060 8:141729794-141729816 CTGGACAGGACAGCGTTGGCGGG - Intergenic
1050283512 9:4077547-4077569 CAGAACAGGAAACCCTGGGTTGG + Intronic
1057951269 9:99370593-99370615 GAGGACAGGACCCTCGTGGTGGG + Intergenic
1058524550 9:105843983-105844005 AAAGATAGGACATCCTTGGTAGG - Intergenic
1060435773 9:123591501-123591523 CAAGACAGGACACCCTCTCTAGG + Intronic
1060765787 9:126294326-126294348 CTGGACAGTACACCCCTGGATGG - Intergenic
1061121796 9:128647795-128647817 CAGACCAGGACATCCTTGGAGGG + Intronic
1061962218 9:133993873-133993895 CAGGACAGGACCCCCATCGGAGG - Intergenic
1062342370 9:136099510-136099532 CAGGACAGGGCCCCCTTGGGTGG - Intergenic
1062520169 9:136954469-136954491 CGGGACAGGAGACCCGGGGTGGG - Intronic
1062520222 9:136954580-136954602 CAGGACAGGAGACCCGGGGTGGG - Intronic
1191162549 X:57346833-57346855 CAGGACATGAAATCCTTAGTTGG + Intronic
1195734965 X:108002673-108002695 CAGGATAGGAAATTCTTGGTTGG - Intergenic
1196432466 X:115641622-115641644 CAGCTCAGGTCACTCTTGGTAGG + Intronic
1199172066 X:144744057-144744079 CAGGACAGGCCACCTTTCCTAGG - Intergenic
1201017415 Y:9619935-9619957 TAGGACAAGAGACCATTGGTTGG + Intergenic
1201059492 Y:10032869-10032891 TAGGACAAGAGACCATTGGTTGG + Intergenic
1202197738 Y:22312164-22312186 TAGGACAAGAGACCATTGGTTGG - Intronic