ID: 1034004432

View in Genome Browser
Species Human (GRCh38)
Location 7:147453432-147453454
Sequence GATCTCCTTGAGTCAGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034004428_1034004432 -9 Left 1034004428 7:147453418-147453440 CCCCATTACGGTGTGATCTCCTT 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1034004432 7:147453432-147453454 GATCTCCTTGAGTCAGGAAATGG 0: 1
1: 0
2: 0
3: 14
4: 215
1034004425_1034004432 17 Left 1034004425 7:147453392-147453414 CCTGTTGCTGTAGTGATAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 86
Right 1034004432 7:147453432-147453454 GATCTCCTTGAGTCAGGAAATGG 0: 1
1: 0
2: 0
3: 14
4: 215
1034004429_1034004432 -10 Left 1034004429 7:147453419-147453441 CCCATTACGGTGTGATCTCCTTG 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1034004432 7:147453432-147453454 GATCTCCTTGAGTCAGGAAATGG 0: 1
1: 0
2: 0
3: 14
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034004432 Original CRISPR GATCTCCTTGAGTCAGGAAA TGG Intronic
900341722 1:2192698-2192720 GATTCCCTTGAGCCAGGAATTGG - Intronic
900396067 1:2453756-2453778 CATCTGCTGGAGTCAGGAGAGGG - Intronic
900631607 1:3639395-3639417 CAGCTCCCTGAGTCAGGGAAAGG - Intronic
900851672 1:5148139-5148161 ACTCTCCTCGAGTCAGGGAATGG - Intergenic
901325256 1:8361485-8361507 GATCTCCTGGAGTCAGAGAAGGG + Exonic
902608173 1:17580851-17580873 GATCTCAGGGAGACAGGAAAAGG - Intronic
907025668 1:51115988-51116010 CATCTCCTTGTCTCAGTAAATGG - Intronic
907737196 1:57125818-57125840 CATCTCCCTGAGACAGAAAATGG - Intronic
913546499 1:119873964-119873986 GAGCTCCTTGTGTCTGGGAATGG + Intergenic
913557441 1:119982070-119982092 GAGCTCCTTGTGTCTGGGAATGG - Intronic
917509456 1:175658217-175658239 GTTGTCCTTGGGTCAGGACAAGG + Intronic
918310563 1:183282438-183282460 GGACTCCTTGAGTCAGGATGAGG + Intronic
918373413 1:183883802-183883824 GATCTCCTTCAGCCTGGAAGAGG + Exonic
920026899 1:203005662-203005684 GAGCTTTTTGAGCCAGGAAAAGG + Intergenic
920162124 1:204006961-204006983 GATCTCCTTCAGTAGGTAAATGG + Intergenic
921794328 1:219325448-219325470 GGTCTTCATGAGTCAAGAAAGGG - Intergenic
923397326 1:233579854-233579876 AATCTCCATGTGTCAGGAGAGGG - Intergenic
924643751 1:245857937-245857959 CTTCTCCTTGAGTCAGGTGAAGG - Intronic
1065927758 10:30450858-30450880 GATCACCTGAAGTCAGGAATTGG + Intronic
1066586624 10:36943547-36943569 CATCCCCTCGATTCAGGAAAGGG - Intergenic
1068666190 10:59678372-59678394 CATCTCCTTGAGAAAGAAAAAGG + Intronic
1068733233 10:60383577-60383599 GAGCTCCTTGAGGCTGGAGATGG - Intronic
1071600063 10:86954674-86954696 TTTGTCCTTGAGTCAGAAAAGGG + Intronic
1074983095 10:118635189-118635211 GGTCACCTTGGGTCAGGAGAGGG - Intergenic
1075396843 10:122133827-122133849 GAACTCCTTGAGGGAGGAACTGG + Intronic
1076407957 10:130225931-130225953 GATGTCCTTCAGTCTGGGAATGG - Intergenic
1080496113 11:32821625-32821647 GTTCTCTTTCAGTCATGAAAAGG - Intergenic
1080891235 11:36410704-36410726 GGTGTCCTTGACTCAGGACATGG - Intronic
1081456652 11:43230130-43230152 GGTTTCCTTGAGTCTGGAAAAGG - Intergenic
1083109223 11:60388570-60388592 TATCTTCTTGAGTCAGGATGTGG + Intronic
1083746387 11:64739390-64739412 GGTCTCCTTGAGGCGGGAGATGG + Exonic
1085182059 11:74544137-74544159 GTTCTGCTTTAGTCAGGAATAGG + Intronic
1086361213 11:86061859-86061881 GATGTCCTTCAGTAAGTAAATGG + Intronic
1087509355 11:99070268-99070290 AATCTCCTTGAGGGAAGAAAGGG - Intronic
1087945697 11:104157656-104157678 GAACTCCTTCAGTCCGGAGAAGG + Intronic
1091130975 11:133147064-133147086 GAACTCCTTCAGTCAGCAACAGG + Intronic
1092021675 12:5207955-5207977 GAACTCCTTGAGGGAGAAAATGG + Intergenic
1092205236 12:6610800-6610822 AATCTCTGGGAGTCAGGAAAAGG - Intergenic
1093163089 12:15772114-15772136 AATCTTTTTGAGTCAGCAAATGG - Intronic
1093321529 12:17720468-17720490 GAGCTTTTTGAGCCAGGAAAAGG + Intergenic
1093394829 12:18668540-18668562 GATCTCCTTGAAGAAGGCAAAGG - Intergenic
1096560023 12:52429487-52429509 GATCTCCTTTTGTCAGGGAAAGG - Intronic
1096722047 12:53530441-53530463 GATCTCCTTGAGAAGAGAAATGG + Intronic
1098042485 12:66366289-66366311 TATCTCTCTGAGTCAGGAACAGG - Intronic
1098372014 12:69769379-69769401 GCTCTCCTTCAGCCAGGATAGGG + Intronic
1099970486 12:89495224-89495246 GATTTCCTTGAATTAGTAAAGGG + Intronic
1101212025 12:102544163-102544185 CATCTGGTTGACTCAGGAAATGG - Intergenic
1101352002 12:103938870-103938892 GATTTCTTTAAGTCATGAAATGG + Intronic
1101573849 12:105979753-105979775 GCTCACCTTGTGTCAGGAATGGG - Intergenic
1103270535 12:119669488-119669510 GATCTCCTGAGGTCAGGAGATGG - Intronic
1104621956 12:130320851-130320873 GATCTCCTTGAGGAACAAAACGG + Intergenic
1106110876 13:26775761-26775783 GATCACCTGAAGTCAGGAATTGG + Intergenic
1106580529 13:31014346-31014368 GATCTCTTTTAGTCAATAAACGG - Intergenic
1108075424 13:46674400-46674422 GCTCTTGTTGAGTCAAGAAAAGG - Intronic
1108460366 13:50660263-50660285 GATTTCATTTATTCAGGAAAAGG - Intronic
1109380454 13:61552251-61552273 ACTCTCCTTGAGACAGGAGAAGG + Intergenic
1111652093 13:91104166-91104188 GATCTCCTTCAGTAGGTAAATGG + Intergenic
1114612814 14:24053447-24053469 GATGTCCCTGAGTCAGGGGACGG - Intronic
1114625010 14:24123290-24123312 GATCTACTGGGGTGAGGAAAAGG - Exonic
1116689496 14:48086732-48086754 GATCTCCTTGATCTAGAAAAGGG + Intergenic
1117620698 14:57583412-57583434 GATATCCTTTAATCAGGAATGGG - Intronic
1118219764 14:63844410-63844432 GATGTCCTTCAGTAAGTAAATGG - Intergenic
1119639592 14:76304850-76304872 GGTCTCCTGGAGTAAGGAAGTGG + Intergenic
1120147811 14:80998904-80998926 CATCTCCATGACTAAGGAAATGG + Intronic
1120374140 14:83678648-83678670 AATCCCCATGTGTCAGGAAAGGG - Intergenic
1121159268 14:91721152-91721174 CATAACCTTGAGTCAGGCAATGG + Intronic
1122737141 14:103849316-103849338 GATGTCCCTGAGTCACGAAGGGG + Intergenic
1125967322 15:43884873-43884895 GCTTTCCCTGAATCAGGAAATGG + Intronic
1127291715 15:57577407-57577429 GACCTTCTGGAGTCTGGAAAAGG - Intergenic
1127960203 15:63885012-63885034 GATCCCCGGGAGTGAGGAAAGGG + Intergenic
1129023780 15:72549307-72549329 GATCACCTTAAGTCAGGAGTTGG - Intronic
1130008531 15:80127364-80127386 GATCACCTTAAGTCAGGAGTTGG + Intronic
1130634016 15:85599170-85599192 TTCCTCCTTGAGTGAGGAAAAGG + Intronic
1132582460 16:691245-691267 AATGTCCCTGAGGCAGGAAAGGG - Intronic
1133173923 16:3999463-3999485 GTCCTCCTTGTGCCAGGAAAGGG - Intronic
1133707134 16:8365522-8365544 CCTCTCATTGAGTCAGGAACTGG - Intergenic
1134572976 16:15307381-15307403 GATCTCTCTGACTCAGGCAAGGG - Intergenic
1134729408 16:16448601-16448623 GATCTCTCTGACTCAGGCAAGGG + Intergenic
1134938027 16:18263249-18263271 GATCTCTCTGACTCAGGCAAGGG - Intergenic
1135266423 16:21030284-21030306 GATTTCCAAGAGTCAGGAAGTGG - Intronic
1136037388 16:27550277-27550299 GACCCCCTTGGGTCAGGAAGTGG - Intronic
1136356783 16:29749306-29749328 GATCTCCTTGTGTCCAGAATTGG - Intergenic
1136583510 16:31169121-31169143 GTCCTCCTGGAGGCAGGAAAAGG - Intergenic
1138759386 16:59522750-59522772 GAGCTTTTTGAGCCAGGAAAAGG + Intergenic
1140817868 16:78637584-78637606 GATGTCAGTGAGTAAGGAAAGGG - Intronic
1141334386 16:83141125-83141147 GATCTCACTGAATCAGGAGAGGG - Intronic
1141853066 16:86660744-86660766 GTCCTCTTGGAGTCAGGAAATGG - Intergenic
1143710456 17:8730953-8730975 GATAACCTTGAGTCATGAAAAGG + Intronic
1143825709 17:9605194-9605216 GATGTCCTTCAGTAAGTAAAGGG + Intronic
1145756906 17:27398880-27398902 GAATTCCCTGTGTCAGGAAACGG + Intergenic
1147026742 17:37592520-37592542 GATGTCCTTCAGTGAGCAAAAGG + Intronic
1147808333 17:43148388-43148410 AATCACCTGGAGTCAGCAAAAGG + Intergenic
1147864688 17:43544856-43544878 GAACTCCTTGAGGCAGGGAAGGG + Intronic
1148460858 17:47838329-47838351 GATCTACCTGAGTCTGGAATCGG + Exonic
1148829956 17:50425192-50425214 CATCTCCTCCAGTCAGGAGAGGG + Intergenic
1150433078 17:65134081-65134103 GAGCTCTTTGAGACAGGAACTGG + Intergenic
1153080798 18:1222260-1222282 GATGTCCTTGAGTAAGCAAGAGG - Intergenic
1153592566 18:6689076-6689098 GATGTCCTTAAGTAATGAAATGG + Intergenic
1157424678 18:47574782-47574804 GAGCTCCTTGAGAAAGGAATTGG + Intergenic
1158613601 18:58965924-58965946 TAACTCCTGGAGTCAAGAAAGGG - Intronic
1158916502 18:62136861-62136883 GTTTTCCTTGCATCAGGAAAGGG - Intronic
1159192798 18:65069833-65069855 GAGCTCCTTGATTCAGGCAGAGG + Intergenic
1159224409 18:65513696-65513718 GATCTCCTTGTGGCATTAAATGG - Intergenic
1160852630 19:1200379-1200401 GATCACCTGAAGTCAGGAATTGG - Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1167549055 19:50147031-50147053 GGTCTCCTTCAGTCTGGAACCGG - Intergenic
1167964800 19:53134708-53134730 GATCTCCTGAGGTCAGGAATTGG - Intronic
928015932 2:27657155-27657177 GGTCTCCTTTAGTCAGTGAATGG - Intronic
928154026 2:28859300-28859322 GATCTCCTGAGGTCAGGAGATGG - Intronic
933900015 2:86842902-86842924 GATCAGCTTGAGGCAGGGAAGGG - Intronic
937049649 2:118878022-118878044 GATGTCCTTGTGTCAGTCAAAGG - Intergenic
938003741 2:127770009-127770031 TATTTCTTAGAGTCAGGAAAAGG - Intronic
939129357 2:138215861-138215883 GAGTTCCTTAACTCAGGAAATGG + Intergenic
939268057 2:139901138-139901160 AATCTCCTAGAGTCAGGAATGGG - Intergenic
939294726 2:140245860-140245882 GCTCTCCTTAGGTCAGGGAAGGG - Intronic
940714259 2:157201472-157201494 GATATCCTTCAGTCAGTGAATGG + Intergenic
941403526 2:165061134-165061156 GATCACCTGAAGTCAGGAATTGG + Intergenic
942829382 2:180221623-180221645 CATCTTTGTGAGTCAGGAAATGG + Intergenic
946580817 2:221126852-221126874 AATCCCCTTGTGTCAGGGAAAGG + Intergenic
948645087 2:239399730-239399752 GCTCTCCGTGAGGGAGGAAAGGG - Intronic
1168765255 20:377898-377920 GATCACCTGAAGTCAGGAGATGG - Intronic
1170813187 20:19691334-19691356 AAAGTCCTTGAGGCAGGAAAAGG + Intronic
1171391934 20:24807191-24807213 GATCCCATTGAGTCAGCAAGGGG + Intergenic
1173195336 20:40909459-40909481 GAACTCCTTGTGTCCGGAATTGG + Intergenic
1176144377 20:63559107-63559129 GATCTCCCTGGGGCAGGAAGTGG - Intronic
1177498613 21:21920647-21920669 GACCTGCTTGAGGGAGGAAAGGG + Intergenic
1182515710 22:30857752-30857774 GGTCTGCTTGAGTCATGAAAGGG + Intronic
1183034682 22:35132530-35132552 GAATTCCTGGAGTCAGAAAAAGG - Intergenic
1184715916 22:46281762-46281784 CATCCCCTTGAGTCAGGCCAAGG + Intronic
1185050666 22:48552511-48552533 GCTCTCCTTGGGTCAGGACATGG + Intronic
1185248370 22:49785587-49785609 GATGTCCTTGACTCAGGACTGGG - Intronic
952894729 3:38070716-38070738 GAGCTTTTTGAGCCAGGAAAAGG + Intronic
953600025 3:44353315-44353337 GATGTCCTTCAGTAAGTAAATGG - Intronic
953943302 3:47121811-47121833 GACCTTCCTGATTCAGGAAAGGG - Exonic
954667885 3:52268405-52268427 GATGCACTTGAGACAGGAAAGGG + Intronic
956471122 3:69567695-69567717 GATCTCCCTGAGTTAGAAATAGG - Intergenic
957140849 3:76354310-76354332 GTTCTCCTTAATTTAGGAAAAGG - Intronic
958429454 3:94020613-94020635 AATCTGTTTGTGTCAGGAAAAGG + Intronic
963674177 3:148287646-148287668 GAACTACTTTAGGCAGGAAAAGG + Intergenic
965122037 3:164572487-164572509 GATCTCTGTAAGTCAGGAAATGG - Intergenic
965796066 3:172439913-172439935 GAGCTCTTTGGGTCAGGGAAAGG - Intergenic
965930074 3:174031288-174031310 AATCTGTTGGAGTCAGGAAATGG - Intronic
966169994 3:177069310-177069332 CATCTCCAGGAATCAGGAAAAGG + Intronic
966217561 3:177519067-177519089 AATCCCCATGTGTCAGGAAAGGG - Intergenic
966427290 3:179792929-179792951 GATGTCCTTGAGCAGGGAAAAGG + Intergenic
966457589 3:180135345-180135367 AACCTCCTTCAGTCAGGTAAGGG - Intergenic
966968727 3:185022029-185022051 AATCTCCATGTGTCGGGAAAGGG + Intronic
968747697 4:2369392-2369414 GAGGCCCTTGAGTAAGGAAAAGG + Intronic
969078244 4:4597861-4597883 GATCACCTGAAGTCAGGAGATGG + Intergenic
970593550 4:17579315-17579337 GATCTCCCTGTACCAGGAAAAGG - Intronic
970764099 4:19525539-19525561 GATCACCTGAAGTCAGGAAATGG + Intergenic
971938012 4:33178127-33178149 GATGTCCTTCAGTCAGTGAATGG - Intergenic
972344426 4:38180995-38181017 GCTCTCCTTCAGCCAGGAATTGG + Intergenic
976068269 4:81214711-81214733 GAGCTCCTGGAGGCAGGGAAAGG - Intronic
984720101 4:182963409-182963431 AATCTCCTTAATTCAAGAAAGGG - Intergenic
984867560 4:184295055-184295077 GATGTCCATGAGCCAGGAAGCGG - Intergenic
986684652 5:10265889-10265911 GATTTCCTAGAATTAGGAAATGG + Exonic
987300664 5:16595125-16595147 TCTCACCATGAGTCAGGAAATGG - Intronic
991138630 5:63213265-63213287 ACTCTCATGGAGTCAGGAAAAGG - Intergenic
993608234 5:90021208-90021230 GAACTCGCTGAGCCAGGAAAAGG + Intergenic
994344510 5:98668841-98668863 AAGCTCCTTGAGCCAGGGAAGGG + Intergenic
994725248 5:103427706-103427728 GATCTCCTTGATTTAACAAAAGG + Intergenic
996713297 5:126564998-126565020 TACCGCCTTGAGTAAGGAAAAGG + Intronic
996915124 5:128703203-128703225 GATCTACCTGAGTCAGGGACTGG - Intronic
999902249 5:156096938-156096960 AATATCCTTGAGGAAGGAAAGGG - Intronic
1004702029 6:18088233-18088255 TATCTCCTTGAGTAATGAGAAGG + Intergenic
1004933916 6:20489078-20489100 TATCTCCTCAAGTTAGGAAATGG - Intronic
1005385635 6:25281419-25281441 GTTGTCCTTAAGTCTGGAAATGG + Intronic
1006025833 6:31146122-31146144 GATCACCTGAAGTCAGGAATTGG + Intronic
1006478178 6:34271527-34271549 GGACTGCTTGAGCCAGGAAACGG + Intergenic
1006654304 6:35577068-35577090 GATCTCCATGTGCCAGAAAAAGG - Exonic
1006874573 6:37284164-37284186 GATCTCATTGAATGAGGAGAGGG + Intronic
1007475074 6:42114226-42114248 GATCCCCTTGTGTCAGAATAGGG - Intronic
1008317750 6:50067269-50067291 GCTCTCCTTGAGTTTGCAAATGG - Intergenic
1008660967 6:53667344-53667366 CACCTCCTTGACTCAGGTAAAGG + Intergenic
1009900843 6:69806349-69806371 TATATGCTTGAGTCAGGAGAGGG - Intergenic
1010623380 6:78104850-78104872 GAACACATTGAGTCAGGAAGTGG + Intergenic
1011368327 6:86605206-86605228 GATATTTTTGAGACAGGAAATGG - Intergenic
1011895479 6:92219212-92219234 GATCACCTGAGGTCAGGAAATGG + Intergenic
1012191688 6:96287587-96287609 GTTCTCCTTCAGTCAGGAGGTGG - Intergenic
1013588630 6:111601647-111601669 GCTTTCTTTGAGTCAGGAATAGG + Intronic
1013589615 6:111609134-111609156 GAGCTACTGGAGTTAGGAAATGG + Intergenic
1015071081 6:129093609-129093631 GATCTCATTTAGTGTGGAAATGG - Intronic
1016024546 6:139272810-139272832 GATCACCTGAAGTCAGGAGATGG + Intronic
1017156138 6:151324231-151324253 TATCTCACTGAGTCAGGACAAGG + Intronic
1019986779 7:4662668-4662690 GATCACCTGAAGTCAGGAGATGG - Intergenic
1021914614 7:25419012-25419034 CATCTCCTTGATTCTGGGAAGGG - Intergenic
1022623482 7:32009279-32009301 GAACTCTCTGAGTCAGGAGATGG + Intronic
1024447835 7:49502258-49502280 GATCTCCTTGTTACAGGAAATGG + Intergenic
1026402537 7:70029422-70029444 GAGCTCCTTGAGTATGGAGATGG + Intronic
1027625137 7:80535047-80535069 GATATTTTTGAGTAAGGAAATGG + Intronic
1029276900 7:99410964-99410986 GACTTCCTTGAGTCAGCATAGGG - Intronic
1030275437 7:107716022-107716044 GATCTCTTTGATCCTGGAAATGG + Exonic
1030409215 7:109153963-109153985 GAACTCCTTGAATCTGGAGATGG + Intergenic
1031240824 7:119237156-119237178 GATTTCCTTGATTAAGCAAATGG + Intergenic
1031652351 7:124305834-124305856 GATCTCTTTAATACAGGAAATGG - Intergenic
1031714740 7:125094858-125094880 GATTTTCTTTATTCAGGAAATGG - Intergenic
1032728685 7:134616162-134616184 GAGCTCCCTGGGTCAAGAAAAGG + Intergenic
1034004432 7:147453432-147453454 GATCTCCTTGAGTCAGGAAATGG + Intronic
1034145088 7:148863212-148863234 GTTCTCTGTGAGTCAAGAAAAGG - Intronic
1037243032 8:16799313-16799335 GATCTTCTCCAGTGAGGAAAGGG - Intergenic
1038373574 8:27015601-27015623 AATCTCCTTAAGTGAGAAAAGGG - Intergenic
1038404080 8:27309036-27309058 AAGCTCCTTGAGGCTGGAAATGG + Intronic
1038769788 8:30466814-30466836 GATCACCTGACGTCAGGAAATGG - Intronic
1039035052 8:33350788-33350810 GATTGCCTTGGGCCAGGAAAAGG + Intergenic
1039801134 8:40955592-40955614 AATGTCCTTGAGGCAAGAAAAGG + Intergenic
1042955978 8:74251068-74251090 GATCACCCTGATTCAGGAAATGG - Intronic
1045877570 8:106999948-106999970 GATTTCCTCTAGTGAGGAAATGG - Intergenic
1047532438 8:125689213-125689235 AATCTAGTTGAGTCAGGAAATGG + Intergenic
1048046493 8:130777945-130777967 GACATCATTGAGTCAGGAACAGG + Intergenic
1052689838 9:31802775-31802797 AATCTCCATGTGTCATGAAAAGG + Intergenic
1055391704 9:75828683-75828705 GGTCTCCCTGAGTAAGGATATGG - Intergenic
1056691814 9:88814310-88814332 GATCACCTGAAGTCAGGAATTGG - Intergenic
1057999074 9:99847139-99847161 GCTTTCCTTGGGACAGGAAATGG - Intronic
1058390189 9:104487323-104487345 TATCTGCTTGAGTCTAGAAAAGG - Intergenic
1060472741 9:123962167-123962189 TAGCTCCGTGAGTTAGGAAATGG + Intergenic
1061947237 9:133915120-133915142 GAACTCCCTGAGCCAGGAAAAGG - Intronic
1187228001 X:17392562-17392584 GCTTTCCTTGAGTAAGCAAATGG + Intronic
1187587901 X:20684344-20684366 AATGTCCTTGAGTCAGGAGGTGG + Intergenic
1188618225 X:32185933-32185955 GATCTCCGAGAGGCAGAAAAAGG - Intronic
1188674061 X:32917032-32917054 AATCTCCTTGTGTCAGGGGAGGG + Intronic
1191145112 X:57157349-57157371 GAGCTACTTTAGTCAGGCAATGG + Intergenic
1193720705 X:84983749-84983771 CATTTTCTTGAATCAGGAAAGGG - Intergenic
1194411011 X:93557795-93557817 GCTCTCTTTTAGTCAGCAAATGG - Intergenic
1196220512 X:113108934-113108956 GAGCTTTTTGAGCCAGGAAAAGG + Intergenic
1199462978 X:148104107-148104129 GATATCCTTTAGTAAGTAAATGG - Intergenic
1200301895 X:154984756-154984778 GAACTCCTTGATGCAGGATAGGG - Exonic
1201233417 Y:11888002-11888024 GATCTCCTGAAGTCAGGAGTTGG + Intergenic
1201615567 Y:15894174-15894196 GTTCTCAGTGAGTCAGGATAAGG - Intergenic
1201650313 Y:16277418-16277440 GATCTCCTTGTGTCTGGAGTTGG - Intergenic