ID: 1034004508

View in Genome Browser
Species Human (GRCh38)
Location 7:147454823-147454845
Sequence TTTTCTTAAAGTTGCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034004508_1034004511 7 Left 1034004508 7:147454823-147454845 CCAGCACTGCAACTTTAAGAAAA 0: 1
1: 0
2: 3
3: 8
4: 226
Right 1034004511 7:147454853-147454875 CGACGACCTTTAATAACACTAGG No data
1034004508_1034004513 30 Left 1034004508 7:147454823-147454845 CCAGCACTGCAACTTTAAGAAAA 0: 1
1: 0
2: 3
3: 8
4: 226
Right 1034004513 7:147454876-147454898 TCTGCCAGTGCTCATTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034004508 Original CRISPR TTTTCTTAAAGTTGCAGTGC TGG (reversed) Intronic
904766823 1:32855830-32855852 TCTTCTTAAAATTGTTGTGCTGG + Intronic
905145080 1:35882165-35882187 ACTTCTTAAATTTGAAGTGCTGG + Intronic
908762919 1:67528442-67528464 TTTGCTGAAAGCTGAAGTGCTGG - Intergenic
908867781 1:68570947-68570969 TTTTTTTAAAGTTCCAGTCAGGG - Intergenic
908896173 1:68902680-68902702 TTTTCTCAAACTTCCTGTGCTGG - Intergenic
909341767 1:74540217-74540239 TTTTATTAATTTTCCAGTGCTGG + Exonic
911255989 1:95634245-95634267 CTTTCTTAAAGTTCCAGTCCTGG + Intergenic
911773186 1:101773610-101773632 CTTTCTTAAAGTCACAATGCTGG + Intergenic
912008229 1:104930511-104930533 TTTTCTTAAAGCCACAGTGAAGG - Intergenic
916007520 1:160675727-160675749 TTTACTTAAACTTGCTGCGCTGG + Intergenic
916693483 1:167213626-167213648 TATTCTTAATGTTACAGTACAGG - Intergenic
917430122 1:174957743-174957765 TTTTCTTAAAGCAGCAGTTGTGG + Intronic
918256558 1:182753923-182753945 TTTTTTTAACCTTGAAGTGCAGG - Intergenic
919417115 1:197324787-197324809 TTTTCTTAAAGTCACAGAGATGG + Intronic
921025417 1:211275739-211275761 AATTGTTAAAGTTGCAGTGGAGG + Intronic
921773281 1:219068721-219068743 TTTTCTTATAGGTGCAGAGAAGG - Intergenic
922513334 1:226187153-226187175 TTTCCTTAGAGTTGCTGTGAAGG - Intergenic
922983410 1:229847875-229847897 ATTTCTTAGAGTGGCAGTGGTGG + Intergenic
924243841 1:242062908-242062930 TTTTCTTACAGTTGGAATGAGGG - Intergenic
1063725270 10:8630286-8630308 TTTTTTTAAAGTTAAAGTTCTGG + Intergenic
1064263950 10:13809516-13809538 TTTTAAAAAAATTGCAGTGCTGG + Intronic
1065759106 10:28965184-28965206 TTTTCTTAGACTTCCAGGGCAGG - Intergenic
1068527139 10:58143295-58143317 ATTTCCTAAATTTGCAGTGATGG + Intergenic
1069357662 10:67606069-67606091 TTTTCTTAAAGTTACGTTGGGGG + Intronic
1070195532 10:74152797-74152819 TTTTCTTATACCTGCAGTCCTGG + Intronic
1071583461 10:86795502-86795524 CTTTCTAAAAGTTGCTGTGAAGG + Intronic
1071795688 10:89002560-89002582 TATTATTAAAGTTTCAGTGAGGG - Intronic
1073321610 10:102619430-102619452 TTTCAATAAAGTTGCTGTGCTGG + Intronic
1073737097 10:106361299-106361321 TTTACATAACATTGCAGTGCTGG - Intergenic
1075545608 10:123352218-123352240 TTTTCCTAGAGGAGCAGTGCTGG + Intergenic
1078723385 11:13904588-13904610 AATTTTTAAAGTTGCAGTGTTGG + Intergenic
1080847874 11:36042218-36042240 TTCTTTTAAACTTGCACTGCAGG + Intronic
1084555433 11:69872912-69872934 TTTTTTAAATGGTGCAGTGCAGG + Intergenic
1084887738 11:72222055-72222077 TTTTCACAAAGTAGCAGAGCTGG - Intergenic
1085554135 11:77404086-77404108 ATTTCTTAAAGTTCTAGAGCTGG - Intronic
1086813050 11:91334996-91335018 TTTTTTTAAAGAAGCAATGCAGG + Intergenic
1087778731 11:102281273-102281295 ACTTCTTAAAGTTACAGTGCTGG - Intergenic
1088843775 11:113648190-113648212 TTTTCTTCAAGGTTCAATGCAGG - Intergenic
1094046221 12:26169872-26169894 TTTTCTGAGGGTTGCAGAGCAGG + Intronic
1094485564 12:30923870-30923892 TCTTGTTAATGGTGCAGTGCTGG + Intergenic
1094813237 12:34162125-34162147 TTTTCTTACAGTTGGAATGAGGG + Intergenic
1095366163 12:41408435-41408457 TTTTCTCAAAGTGGAAGTGTGGG + Intronic
1101038266 12:100726858-100726880 TTTTTTTAATGTTGCACTACTGG - Intronic
1104784217 12:131439234-131439256 TTTTCCTCCAGTTGCGGTGCTGG - Intergenic
1105766603 13:23566341-23566363 TTTTCTTAAAGGGCCAGTTCAGG - Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1106874841 13:34060231-34060253 TGTTCTTACAGTTGGAGTTCAGG - Intergenic
1106997482 13:35503618-35503640 ATTTCTTAAGGTAGCATTGCTGG + Intronic
1109422546 13:62132184-62132206 TTTCCTTAATGATGGAGTGCAGG + Intergenic
1109748952 13:66664887-66664909 TATTTTTTAAGTTGCAGTGAAGG - Intronic
1109868660 13:68301947-68301969 TTTTCTTGAAGTGGCCGTGGAGG - Intergenic
1110405027 13:75141189-75141211 TTTTCTAAAAGTAGTATTGCTGG + Intergenic
1113425436 13:110204046-110204068 TTTTCTCAAATTTGCATTGGAGG + Intronic
1118198433 14:63649761-63649783 TGTTGTTAAAGTTGCAGAGTAGG + Intergenic
1118732473 14:68678037-68678059 ACCTCTTAAAGTTGTAGTGCAGG - Intronic
1119272057 14:73315568-73315590 TTTTCTTAGATTAGCAATGCAGG + Intronic
1122164800 14:99814433-99814455 TTTTCTAAATTTTGTAGTGCTGG + Intronic
1123918716 15:25055783-25055805 TTGTCCTGAAGGTGCAGTGCGGG + Intergenic
1124375268 15:29125563-29125585 TTTTCATGAAGTGGAAGTGCAGG - Intronic
1125138147 15:36368381-36368403 TTTTCTGAAATTTTAAGTGCTGG + Intergenic
1125204224 15:37133978-37134000 TTTTCTTAAAGCTGCCCTGTGGG + Intergenic
1125729634 15:41885913-41885935 TTTCCTTAAGGATGCAGAGCAGG - Exonic
1126389263 15:48128259-48128281 TTTTTTTAAAGTTTCATAGCTGG - Intronic
1129591570 15:76919790-76919812 TTTTATAAAAGTTGAAGTCCAGG + Intergenic
1129894908 15:79096282-79096304 ATTTCTGAAAGTTGCACTTCGGG + Intergenic
1129994802 15:79995241-79995263 TTCTCTTAAAGTTCCATTCCTGG - Intergenic
1130164360 15:81437326-81437348 TTTGCTCAAAGCTCCAGTGCTGG + Intergenic
1135468234 16:22705824-22705846 TTTTCTTAAATGTGAAGTGCTGG + Intergenic
1135778857 16:25281129-25281151 TTTTCTTAGAGTGGAATTGCTGG + Intergenic
1137479487 16:48839907-48839929 AATTCTTAAGGTTGCAGTGATGG + Intergenic
1140168239 16:72576816-72576838 TTTTCTTAAAGTTGCCATGCGGG + Intergenic
1141352163 16:83308081-83308103 TTTTCTTAAATATGTTGTGCGGG + Intronic
1146805976 17:35865306-35865328 GTTTCTTGAAGTAGCAGTACGGG + Exonic
1148631132 17:49110172-49110194 TTCTTTTAATTTTGCAGTGCAGG + Intergenic
1149400098 17:56287171-56287193 TTTACTCAAAGTCGCAGAGCTGG + Intronic
1149650086 17:58271248-58271270 TTTTCCCAAAGGTGCAGTACAGG + Intronic
1152256317 17:79242058-79242080 TTTTCCTAAATGTGCAGTGACGG + Intronic
1156440478 18:37182197-37182219 ATTTCTTAAAGTTGAAGTTAAGG - Intronic
1156615165 18:38774512-38774534 TTTTATGATAGATGCAGTGCTGG - Intergenic
1157761722 18:50270227-50270249 ATTACTTAAAGCTGCAGGGCTGG + Intronic
1163893519 19:20037805-20037827 ATTTCTTAGAGATACAGTGCTGG - Intronic
1164107014 19:22116461-22116483 CTTTATTACATTTGCAGTGCAGG - Intergenic
1164887743 19:31797350-31797372 TTTTCTGAAAGCTGCAGAGGAGG + Intergenic
1164928661 19:32153871-32153893 ATTTCTTAAAATTGAACTGCTGG + Intergenic
1165214572 19:34261282-34261304 TTCTCTTAGTGTTGCAGTGAGGG + Intronic
1165372585 19:35418749-35418771 TTTTCTCAAAGTCACAGAGCTGG + Intergenic
1165377171 19:35450817-35450839 TTTTTTCAAAGTCGCAGTCCTGG - Exonic
1166215129 19:41329932-41329954 TTTTTTTAAAGATGCAGTCTTGG + Intronic
1166273069 19:41730108-41730130 CTTTTTTAAAGTTGCTTTGCTGG - Intronic
926784900 2:16509195-16509217 CTTTCTCAGAGTTGCAGTCCTGG + Intergenic
928527378 2:32155517-32155539 TTTTTTTAAAGTTTCATTGAAGG - Exonic
931937104 2:67211258-67211280 TTATCTTTTAGTTGCAGTGCAGG - Intergenic
932959930 2:76401613-76401635 TATTTTTAAAGTAGCTGTGCTGG - Intergenic
935791374 2:106593329-106593351 TTTTTTTAAAGTGGTAGGGCAGG + Intergenic
938762255 2:134436556-134436578 TGTCCTTAAAGCTGCACTGCAGG - Intronic
940190319 2:151033891-151033913 TTTTCTTATAATTGCATTTCAGG - Exonic
942530947 2:176909608-176909630 TTTTTTTAAAGTTTAAGTTCTGG - Intergenic
943995993 2:194766224-194766246 TCTTCTTAAATTTGCAGTTTTGG + Intergenic
945088036 2:206153588-206153610 TTTTCTTAAATTTGCATTCGTGG - Intronic
945353540 2:208811408-208811430 TTTACTTAAATTTCAAGTGCAGG - Intronic
945813750 2:214578465-214578487 TTTTCTCAAAGTTTCACTGCAGG + Exonic
1169529661 20:6471328-6471350 TTTTCTGAAAGGTGAAGAGCTGG - Intergenic
1169635442 20:7686147-7686169 TTTTCTTAAGCTTGCAGAACTGG - Intergenic
1172871419 20:38137842-38137864 TTTTCTTAAGGTTGCACAGTTGG - Intronic
1173720653 20:45254738-45254760 TTTTCTGATAGTTGCTGTGTTGG - Intergenic
1179193561 21:39143835-39143857 ATTTCTTAAACTTTCGGTGCTGG - Intergenic
1180558778 22:16598840-16598862 TATTATTAAAGTTGCACTGTAGG - Intergenic
950505572 3:13392432-13392454 TTTTCTTAGAGGTCCAGAGCAGG + Intronic
951972514 3:28463203-28463225 TTTTATTAAATTTTCAGTGGAGG - Intronic
955436598 3:58906626-58906648 TTTCCTTCAAGATGCAGTACAGG + Intronic
955457722 3:59142433-59142455 TTTTCTGAAACTTTCAGTCCTGG + Intergenic
955847144 3:63177902-63177924 TTATCTCTAAGTTGCAGTGATGG - Intergenic
956726397 3:72160175-72160197 TTTTCCTAAATTTGCACAGCTGG + Intergenic
957264671 3:77947697-77947719 TGTCCTTAAAGTAGCAGTGGAGG - Intergenic
957525611 3:81375248-81375270 TTATCTTACATTTGCAGTGGTGG - Intergenic
958599792 3:96280981-96281003 CTTTCTTCAAGTTTCACTGCTGG - Intergenic
959425918 3:106188310-106188332 TTTTCTTAAAATTACAGGGTTGG - Intergenic
959491136 3:106989623-106989645 TTTTCTGAAAGTGGAAGAGCTGG - Intergenic
961392351 3:126560026-126560048 TTTTCTAAAAGTTGAAGAGGTGG - Intergenic
962895678 3:139712314-139712336 TTCTCTTAAAGTTGTAGTGCTGG + Intergenic
963362291 3:144289792-144289814 ATGTTTTAAAGATGCAGTGCCGG + Intergenic
965407501 3:168288302-168288324 ATTTCTGAAAGCTACAGTGCAGG - Intergenic
965906236 3:173709861-173709883 TTTCCTTAAGGGTGGAGTGCAGG + Intronic
966131879 3:176650625-176650647 ATTTCTTAAAATTGTAGTGAAGG + Intergenic
966594701 3:181715168-181715190 ATTTCTTAAATTGGCAGCGCGGG + Intergenic
970094089 4:12443011-12443033 TTTTCTTAAAATCCCAATGCTGG - Intergenic
970235583 4:13955242-13955264 TTTTTTTAAAGTTGTAGTTAAGG + Intergenic
970292613 4:14591411-14591433 TTTTCTTGGAGTGGCATTGCTGG - Intergenic
972821325 4:42705294-42705316 TTTTATTACAGTTGCTGTTCTGG + Intergenic
974089235 4:57293556-57293578 TTTCCTTCATGGTGCAGTGCAGG - Intergenic
974401638 4:61415536-61415558 TTTGCCTAAGGTTGAAGTGCTGG + Intronic
975735276 4:77374342-77374364 TTTTCATAAAGTTCCCATGCTGG + Intronic
976366998 4:84243901-84243923 TTTTCTCAAAGCTGCATTGGAGG + Intergenic
977106445 4:92891247-92891269 TTTTCTTATAGTTTGAGTTCTGG - Intronic
977488174 4:97675784-97675806 CTTTCTTATAGTTGGAGTTCTGG + Intronic
977684164 4:99828779-99828801 TTTCCTTCAAGTTGAATTGCTGG + Intronic
977749556 4:100592956-100592978 TTTTCATCAAGTTACAGTGTAGG - Intronic
979623092 4:122817838-122817860 TTTTCTAAGAGTTGCATTGGAGG - Intergenic
980133368 4:128837039-128837061 TTTTCCTAAAGTTATAGAGCAGG + Intronic
980776452 4:137442908-137442930 ATTTATTAAAGTTGGAGTGATGG - Intergenic
981027545 4:140092255-140092277 TTTTCTGAAAGTTTCCTTGCAGG - Intronic
982715514 4:158803066-158803088 TTTTGTGAAAGTAGCAGTGGTGG + Intronic
983255029 4:165388771-165388793 TTGTGTTTTAGTTGCAGTGCTGG + Intronic
984082652 4:175267634-175267656 TTTTCTTGAAGTAATAGTGCTGG + Intergenic
987028081 5:13948175-13948197 CTTCCTGCAAGTTGCAGTGCTGG - Intergenic
987988701 5:25181910-25181932 TTTTCTTTAATTTTAAGTGCTGG + Intergenic
990106007 5:52262459-52262481 TTTTATTAAAGTTTCAGTTAAGG - Intergenic
990181462 5:53164970-53164992 GTTTCTTTAACTTCCAGTGCAGG - Intergenic
991545097 5:67772933-67772955 GTTTCTTAGAGTTGTAGAGCTGG + Intergenic
994117302 5:96074971-96074993 TTTTCTTTAGGCTGCAGAGCTGG + Intergenic
994219148 5:97174783-97174805 TGTTCTTAGACTTGCAGTGGTGG + Intronic
995127059 5:108588719-108588741 TTTTCCCAAAGTTACAATGCAGG + Intergenic
996423528 5:123288214-123288236 TTTTCTTAACTATTCAGTGCTGG + Intergenic
997276350 5:132595559-132595581 TTTTCTTAAAATAGCCATGCTGG + Exonic
997592542 5:135084750-135084772 TTTTCTTGAAGTGGGATTGCTGG + Intronic
997855904 5:137372436-137372458 TTCTTTAAAAGTTACAGTGCAGG - Intronic
998888053 5:146715385-146715407 TTTTCTAAACTGTGCAGTGCTGG - Intronic
999872359 5:155765759-155765781 TTTTCTTGAAAATGCTGTGCTGG + Intergenic
1000107006 5:158069336-158069358 TTTTTTTTTAGTTGGAGTGCGGG + Intergenic
1000717149 5:164659170-164659192 TTTTATTAATGTTGTAGTGTTGG - Intergenic
1000756333 5:165165302-165165324 TTTTTTGAAAGTTGCAATCCAGG - Intergenic
1000887853 5:166767926-166767948 TTTTATTAAATTTGCAATGATGG + Intergenic
1002316043 5:178344053-178344075 TTTTCTAAAAGTTCAAGTGATGG - Intronic
1003702480 6:8483819-8483841 GTGTCCTAAAGTTGCAGTTCAGG + Intergenic
1007144132 6:39610217-39610239 TTTTTTTTAAGTTGAACTGCTGG - Intronic
1007164959 6:39822685-39822707 TTTCCTTAAAGATGCAGGGCTGG + Intronic
1009528934 6:64785116-64785138 TTTTCTTGAAATTGCAGTTCAGG - Intronic
1010809052 6:80278083-80278105 TTTCATTAAAATTGCCGTGCTGG + Intronic
1011899382 6:92273571-92273593 TTCTTTTAAATTAGCAGTGCCGG - Intergenic
1013650809 6:112192767-112192789 TTTTCCCAAAGCTGCCGTGCAGG + Intronic
1013896113 6:115090396-115090418 TATTCTTAAAGATCCAGTTCAGG - Intergenic
1015225033 6:130847745-130847767 GTTTCTAAAAGTAGTAGTGCCGG + Intronic
1015632981 6:135249499-135249521 TTTTTTTAAAGTAGAACTGCAGG + Intergenic
1016606372 6:145933492-145933514 TTCTAATTAAGTTGCAGTGCTGG - Intronic
1016797284 6:148131506-148131528 TTTTCATAAAGTTGCAGGGCTGG - Intergenic
1017601798 6:156091543-156091565 TTTTTTTAAAGTTTGAGTTCTGG - Intergenic
1019166635 6:170101669-170101691 TTTTCTGGAAGTTGGAGGGCGGG - Intergenic
1021570256 7:22057757-22057779 TTTCCTTAAAATTGCAATGAAGG + Intergenic
1021763472 7:23923957-23923979 ATTTCCTAAACGTGCAGTGCAGG + Intergenic
1023060661 7:36322863-36322885 TCTTCTTAAAGATACAGTGTTGG + Intergenic
1023319566 7:38978686-38978708 GTTTATTAAAGCTGCTGTGCTGG - Intronic
1023775359 7:43600725-43600747 TTTTCTAAAAGTAAAAGTGCTGG - Intronic
1024657751 7:51466193-51466215 TTTTCTTTATGTTGCAGAGTTGG + Intergenic
1027871110 7:83709642-83709664 TTTGCTGAAAGGTGCAGTGAAGG + Intergenic
1028029350 7:85889944-85889966 TTTTCTTGGAGCTGCAATGCAGG - Intergenic
1029157540 7:98527977-98527999 TTTTCTTAAAAATGCAGTCCTGG - Intergenic
1030289826 7:107861034-107861056 TTTACTTAAAATTGGAGGGCTGG + Intergenic
1031163689 7:118200379-118200401 CTTTCTTAAAGATGCTGTGTAGG - Intergenic
1031503824 7:122556395-122556417 TTTTTTTAAAGTTGGTGTGGGGG - Intronic
1031601098 7:123710874-123710896 TTTTCTGAAGTTTTCAGTGCTGG - Intronic
1031659758 7:124407813-124407835 TTTTTTTAAATCTCCAGTGCTGG + Intergenic
1032685224 7:134225946-134225968 TCTTCTTAGGGTTGCAGTGAGGG - Intronic
1032832278 7:135640207-135640229 TTTTCTTTAACTTGAAGTTCTGG - Intronic
1032836274 7:135677828-135677850 TTTTCTTAAACTTCCAGTCTTGG + Intronic
1033150673 7:138912455-138912477 TTTGCTTTCATTTGCAGTGCTGG - Exonic
1034004508 7:147454823-147454845 TTTTCTTAAAGTTGCAGTGCTGG - Intronic
1034618537 7:152439163-152439185 TATTATTAAAGTTGCACTGTAGG + Intergenic
1035882758 8:3260241-3260263 TTTTCTCAAAGTTGCTCTTCAGG + Intronic
1038285164 8:26199845-26199867 TTTTCTTAAGGTTTCTTTGCTGG - Intergenic
1038784482 8:30599204-30599226 TTTTCTTGAGGTTGAATTGCTGG - Intronic
1039305818 8:36261200-36261222 TTTTCTTATAGTTTAAGTTCTGG - Intergenic
1039886909 8:41659984-41660006 TTTTCTTATGGTAGCAGTGGCGG - Intronic
1040716257 8:50256702-50256724 ATTTCTTAAAAATGCAGTTCTGG - Intronic
1040957976 8:52999238-52999260 TTTTTCAGAAGTTGCAGTGCTGG - Intergenic
1042227795 8:66528026-66528048 TTATCTTACAGTTACAGTTCTGG + Intergenic
1042311627 8:67384643-67384665 TTTTCTGACTGTAGCAGTGCGGG + Intergenic
1042905503 8:73768036-73768058 TTTTATTAGAGTTGAAGTGGTGG + Intronic
1043063818 8:75541064-75541086 TTTCCTGAAAGTTGCACTACAGG - Intronic
1044370273 8:91402355-91402377 TTTTCTTAAATTTGTAGTTAGGG + Intergenic
1045423165 8:102036958-102036980 TTTTCTTTAAGTTACATTCCAGG - Intronic
1045630235 8:104110729-104110751 TTTTTTTAAAGCATCAGTGCAGG - Intronic
1046364846 8:113213673-113213695 TTTTTTTAAAGTTGCTGTATGGG - Intronic
1046528401 8:115411908-115411930 GTTTCTTAAAGTTGGATGGCAGG - Exonic
1048269868 8:133020091-133020113 TTATCTTAAAGGTGCAGACCTGG + Intronic
1048511041 8:135063077-135063099 TTTTATTAAAGTTCCTTTGCAGG + Intergenic
1049113217 8:140662844-140662866 TATTCTTAAAGTTGGATTGAGGG - Intronic
1049271759 8:141699880-141699902 TTTTCTCAAAGCTGCCTTGCTGG + Intergenic
1051074949 9:13222571-13222593 TTTTTTTAAAGTAGAACTGCAGG - Intronic
1053087512 9:35238986-35239008 ATTTCTTAAAGTAGAATTGCTGG + Intronic
1053559767 9:39179014-39179036 TAGTCTTGATGTTGCAGTGCAGG + Intronic
1053823875 9:41999258-41999280 TAGTCTTGATGTTGCAGTGCAGG + Intronic
1054137349 9:61439929-61439951 TAGTCTTGATGTTGCAGTGCAGG - Intergenic
1054606697 9:67188109-67188131 TAGTCTTGATGTTGCAGTGCAGG - Intergenic
1061772240 9:132934730-132934752 TTTTCCTAAAGATGCATAGCTGG - Intronic
1062105065 9:134750773-134750795 TTGTCTTACACTTGCAGTTCCGG + Exonic
1062358773 9:136177732-136177754 TGTGCTTAGGGTTGCAGTGCTGG + Intergenic
1186113506 X:6280117-6280139 TTTTCTTATAGATGCAGAGACGG + Intergenic
1188576160 X:31652766-31652788 TTTTCATAAAGTGGTGGTGCTGG + Intronic
1188750073 X:33893954-33893976 TTTCCTAAAAGTAGCAGTCCTGG + Intergenic
1189821954 X:44877933-44877955 TTTTCTTAAATTTGGTTTGCTGG + Intronic
1193464413 X:81830416-81830438 TTTTATTAAATTTGAAGTCCAGG + Intergenic
1194439424 X:93912749-93912771 TTGTAATATAGTTGCAGTGCTGG + Intergenic
1194556446 X:95366953-95366975 TTTTCTTCAAGAAGCAATGCAGG + Intergenic
1195280162 X:103325059-103325081 TTTACTTAAAGTTAAACTGCAGG - Intergenic
1197418172 X:126202516-126202538 TTATTTTAAATTTGTAGTGCTGG + Intergenic
1199466946 X:148148705-148148727 TTCTCACAAAGTTGCAGTCCGGG - Intergenic
1199667762 X:150114370-150114392 TTTGCTCAAAATGGCAGTGCTGG + Intergenic
1202110750 Y:21416423-21416445 TATTAATAAAGTGGCAGTGCAGG + Intergenic