ID: 1034009533

View in Genome Browser
Species Human (GRCh38)
Location 7:147513933-147513955
Sequence CCTTCAGATGAGGGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034009533_1034009545 10 Left 1034009533 7:147513933-147513955 CCCTCCTTCCCCTCATCTGAAGG 0: 1
1: 0
2: 1
3: 53
4: 324
Right 1034009545 7:147513966-147513988 CCACATGGTCCTTTCACCAGAGG 0: 1
1: 0
2: 0
3: 3
4: 119
1034009533_1034009540 -5 Left 1034009533 7:147513933-147513955 CCCTCCTTCCCCTCATCTGAAGG 0: 1
1: 0
2: 1
3: 53
4: 324
Right 1034009540 7:147513951-147513973 GAAGGCCAACCACCACCACATGG 0: 1
1: 0
2: 1
3: 18
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034009533 Original CRISPR CCTTCAGATGAGGGGAAGGA GGG (reversed) Intronic
900394199 1:2446469-2446491 CCTGCAGCTGGGGGGAGGGAGGG - Intronic
901333836 1:8431560-8431582 CCATGGGCTGAGGGGAAGGATGG - Intronic
902580096 1:17402706-17402728 CCTTCAAATATGGGGAGGGATGG + Intergenic
903186061 1:21629653-21629675 CCTTCAGGTCTGGGGATGGATGG - Intronic
903480859 1:23652370-23652392 CCTGCAGAAGAGGGGAAGGTGGG + Intergenic
904609261 1:31716002-31716024 CCTGGAGATGGGGGGAAGAAGGG - Intergenic
904678293 1:32212005-32212027 CCTACATGTGAGGGGAAGGGTGG - Intronic
904842412 1:33381334-33381356 CTTTCAGATGAGGAGTAGGATGG - Intronic
905147078 1:35895098-35895120 TGTTCAGAAGAAGGGAAGGAAGG - Intronic
905299888 1:36979858-36979880 TCCTGAGATGAGGGTAAGGAGGG + Intronic
907204759 1:52759533-52759555 CCTTCAGATGAGGAAACTGAGGG + Intronic
907408876 1:54270935-54270957 CCTTCACAGAAGGTGAAGGAGGG + Intronic
908000856 1:59677467-59677489 CCTTCAGATGCTGGGAAGGCTGG + Intronic
909939360 1:81592633-81592655 CTTTCGGAGAAGGGGAAGGAAGG + Intronic
910191242 1:84598135-84598157 CCCTCAGCTGCGGGGTAGGATGG - Intergenic
910213594 1:84819085-84819107 CCTTATGCTGACGGGAAGGAAGG - Intronic
910262054 1:85302523-85302545 CCTTCAGCAGATGGGAAGGAGGG + Intergenic
911666270 1:100556932-100556954 CCTTCAGATTGGGGGAAAGAGGG - Intergenic
912528070 1:110299565-110299587 CTTTCAGATGGGGGCCAGGAAGG + Intergenic
914712492 1:150227587-150227609 ACTTCAAAAGAGGGGAAGGAGGG + Intronic
915623402 1:157099575-157099597 ACTTAAGAGGAAGGGAAGGAAGG + Exonic
915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG + Intergenic
916175722 1:162036682-162036704 CCTGCAGATGAGAGGAAGTCAGG + Intergenic
916184089 1:162113830-162113852 CCTTCCTAAGAGGTGAAGGATGG - Intronic
917159658 1:172043273-172043295 CCATCAGATGAGGGAAATGGAGG + Intronic
918290072 1:183099002-183099024 CCTAAAGAAGAGGAGAAGGAGGG - Intronic
918297334 1:183169370-183169392 CCTTCAGATGAAGTGGACGATGG + Intergenic
919122663 1:193360633-193360655 TCTTCAAATCAGGTGAAGGAAGG + Intergenic
919202469 1:194373594-194373616 CATTCAGATGAGTGCAAGTAAGG + Intergenic
920284704 1:204871057-204871079 CCTTCAGGAGAGAGGTAGGATGG + Intronic
920331378 1:205211071-205211093 CCTTCTGAGGAGGGGAGGAAGGG - Intronic
920631730 1:207659280-207659302 CCCTCTGCAGAGGGGAAGGAAGG - Intronic
920984647 1:210875001-210875023 CCTACACTTGAAGGGAAGGAAGG + Intronic
921085294 1:211785396-211785418 CTATAACATGAGGGGAAGGAAGG - Intronic
921923928 1:220696186-220696208 CTTTCAGATAAGGTGAAGGAAGG + Intronic
922182540 1:223246586-223246608 CTTCCACATGAGTGGAAGGAGGG + Intronic
923044473 1:230345433-230345455 CCTGCAGATGAGGGGAGAGGAGG + Intronic
923123833 1:231018374-231018396 CCTTCAGGTTAGGGAGAGGAAGG - Intergenic
923551040 1:234963592-234963614 CCTCCAGGGGAGGGGAAGGCTGG - Intergenic
923872516 1:238011262-238011284 CTTTCAGAATAGGGGAAGGATGG + Intergenic
1063072014 10:2676182-2676204 CGTTCAGGTGAAGGGAAGGCAGG - Intergenic
1063497167 10:6520639-6520661 GCTCTAGAGGAGGGGAAGGAAGG - Intronic
1063746905 10:8894057-8894079 ACTCCAGATGAGGAGAATGAAGG + Intergenic
1064236491 10:13580789-13580811 CCTGCAGATGAGGGACAGGTGGG + Intergenic
1064266568 10:13830235-13830257 CCTGCAAATGGAGGGAAGGAGGG - Intronic
1066162503 10:32748703-32748725 CCTTCTTATGTGGGGCAGGATGG + Intronic
1067232275 10:44420142-44420164 CCTTCATATGTGGTGAAGGGAGG + Intergenic
1067660784 10:48235011-48235033 CCCTCAGCTGAGGGGAAGAAGGG - Intronic
1069618746 10:69823358-69823380 TCTTTAGAGGTGGGGAAGGAAGG + Intronic
1069680815 10:70283944-70283966 CCTCCCGACCAGGGGAAGGAGGG + Intergenic
1069892329 10:71659808-71659830 CCATCTGATGAGGAGGAGGAAGG + Intronic
1071469878 10:85976475-85976497 CCTTCAGGTGAGTAGAAGGAAGG + Intronic
1071486573 10:86106454-86106476 GCTTCAGGTGTGGGGATGGAGGG + Intronic
1071652485 10:87406601-87406623 CCTCCAAAACAGGGGAAGGAAGG + Intergenic
1072704879 10:97673933-97673955 CCTTCTGATGTGGGGGAGGCTGG + Exonic
1073284616 10:102380209-102380231 CCTTCAGCTGAGGGGACTGTAGG - Intronic
1075171892 10:120123079-120123101 GCCTGAGATGAGGGAAAGGAAGG + Intergenic
1075542759 10:123329310-123329332 CTTTCCAATGAGGAGAAGGAAGG - Intergenic
1075648042 10:124109357-124109379 CCTTCAGATGAGTGTCAGGGTGG - Intergenic
1075903017 10:126058142-126058164 CCTTGGGAGGAGGGAAAGGAGGG - Intronic
1076271702 10:129158272-129158294 CCTTCAGATGTGGGGATGTGGGG - Intergenic
1076531659 10:131149118-131149140 CCTTCAGATGGGGGGTGGAATGG + Intronic
1077268183 11:1662379-1662401 ACTGCTGAGGAGGGGAAGGATGG - Intergenic
1077272699 11:1689239-1689261 ACTGCTGAGGAGGGGAAGGATGG + Intergenic
1077526337 11:3067903-3067925 CCTTCTGGGGAGGGGTAGGATGG + Intergenic
1078220787 11:9350001-9350023 CCTCCAGCTAAGGGGAAGGAAGG - Intergenic
1078265838 11:9755934-9755956 ACTTCCGATGAGGAGGAGGAGGG - Intergenic
1078492169 11:11779524-11779546 TATTCAGATAAGGGGAAGGGAGG + Intergenic
1080506443 11:32918669-32918691 GCTGAGGATGAGGGGAAGGAGGG + Intronic
1080796167 11:35565591-35565613 CCTGAAGATGATGGGAGGGAAGG + Intergenic
1080899898 11:36479890-36479912 ACCTCAGATTGGGGGAAGGAGGG + Intergenic
1081568431 11:44275076-44275098 CCTCCAGCAGAGGGGCAGGAAGG - Intronic
1081737572 11:45414717-45414739 CCTTCAGCTGAGGGGAGGAATGG - Intergenic
1082655674 11:55854063-55854085 CCTACAGATGAGAAGAAGAAAGG - Intergenic
1082997207 11:59263706-59263728 CCTGCAGAGGAGGAGAAGGCAGG + Intergenic
1083397938 11:62404159-62404181 GCTTCAGGTGGGGGGAAGAAGGG + Intergenic
1084909058 11:72372999-72373021 TCTTCAGATGGGGGACAGGACGG - Exonic
1086240187 11:84681239-84681261 CCCCCATATCAGGGGAAGGAAGG - Intronic
1088504310 11:110513702-110513724 CCTTCAGAGTCGGGGAGGGAAGG + Intergenic
1088719092 11:112576259-112576281 CCTTCAGATGAGGGCAGGGGAGG - Intergenic
1089114161 11:116080743-116080765 CCTTCAGATGGTGAGAAGGAAGG - Intergenic
1089195508 11:116692124-116692146 CCTTCAGCTGGGGGGATGGATGG - Intergenic
1089221248 11:116873665-116873687 CCATGAGATGAGGGGAAGGCGGG + Intronic
1089390695 11:118099681-118099703 TCTGCAGAAGATGGGAAGGAGGG - Intronic
1089583664 11:119496826-119496848 TCATCAGATGGGTGGAAGGATGG + Intergenic
1089760407 11:120718589-120718611 CCTTGAGATGGAAGGAAGGAGGG + Intronic
1090332615 11:125943399-125943421 CCTTGGGAAGGGGGGAAGGAGGG + Intergenic
1090424321 11:126596483-126596505 CCTTCTGAAGGGGGGAAGGTAGG + Intronic
1090903161 11:131050306-131050328 CCTTCAGATGAGGTGGAGGTGGG - Intergenic
1091368136 11:135038687-135038709 CCTTCAGCTGAGGGCAGGCATGG + Intergenic
1091446152 12:545329-545351 TTTCCAGATGAGGGCAAGGAGGG - Intronic
1092147725 12:6226267-6226289 CCTTCAGAGGAGGGGGAGCCTGG + Intronic
1093529768 12:20147079-20147101 CCATCAGATGAGAGTGAGGAGGG + Intergenic
1094008474 12:25781578-25781600 ACTTCACATGTTGGGAAGGAGGG - Intergenic
1094709946 12:32952001-32952023 CTTTCTGCTGAGGGGAGGGAAGG - Intergenic
1095128477 12:38509539-38509561 CCTGCAGATGACGGGGAGAATGG + Intergenic
1095221635 12:39622960-39622982 CCTTCAGATAAGGCAGAGGAAGG + Intergenic
1095511466 12:42955356-42955378 CCTTTAGAATAGGGGAAGAAGGG + Intergenic
1095961798 12:47839567-47839589 CCTGCAGATGACAAGAAGGATGG - Intergenic
1096195540 12:49646909-49646931 CCTGTTTATGAGGGGAAGGATGG - Exonic
1096229507 12:49889325-49889347 CCACCTGATGAGGGGGAGGAGGG - Intronic
1098636735 12:72793157-72793179 CCATCAGATAAGAGGAAGAATGG - Intergenic
1102101441 12:110281529-110281551 CCTTCTGGCGAGGGGAGGGAGGG + Intronic
1103512357 12:121484121-121484143 CCTGCAGGAGAGGGGAAGGTGGG - Intronic
1104064606 12:125296616-125296638 CCATCCCATGAGGGGAAGAATGG + Intronic
1104490911 12:129192439-129192461 CCTTCCCATGAGGGGAAAGATGG + Intronic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106098067 13:26667699-26667721 CCTTGAGATGAGGGGAGAGCTGG + Intronic
1106171611 13:27293433-27293455 CCTTCCGATGAAAGGATGGAGGG - Intergenic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1107803461 13:44132096-44132118 CTGTCTGGTGAGGGGAAGGAGGG + Intergenic
1107836589 13:44416572-44416594 GCTGGAGATGAGGGGAGGGAGGG - Intergenic
1109932047 13:69228749-69228771 ATTTAAGAAGAGGGGAAGGAGGG - Intergenic
1110589236 13:77235698-77235720 CATTCTAATGAGGGGAGGGAGGG + Intronic
1112726597 13:102311463-102311485 GATTCAGCTGTGGGGAAGGATGG - Intronic
1113400222 13:109985687-109985709 ACTTCAGAGGAGATGAAGGAAGG - Intergenic
1113457475 13:110458749-110458771 CCTGCAGAGGAGGGAGAGGAGGG - Exonic
1115379477 14:32718986-32719008 ACTTCAGATGAGGATAAGTATGG - Intronic
1116246502 14:42421161-42421183 ACTTCAGGTGAGGGGAAGGTAGG - Intergenic
1116801020 14:49443287-49443309 TCCTAAGATGAGAGGAAGGAAGG - Intergenic
1118317038 14:64731800-64731822 CATCCAGGTGAGGGGAAGGTGGG + Exonic
1119123030 14:72097671-72097693 CCGGCAGAGGAGGGGGAGGAAGG - Intronic
1119522907 14:75299143-75299165 CCTTCAGTAAAGGGGAAGGAGGG + Intergenic
1119579480 14:75764127-75764149 GGTTCAGATGAGGGGAACAAAGG - Intronic
1120516815 14:85480826-85480848 CTTTGAGATGAGGGGCAGGATGG + Intergenic
1121119927 14:91370248-91370270 CCTTCAGAAGGGGGAAGGGAGGG + Intronic
1124237857 15:28005179-28005201 CCTTCTGAGGAGGGGAAGTGGGG - Intronic
1124347463 15:28932146-28932168 CAATGAGATGAGGGGTAGGAGGG + Intronic
1125747420 15:42006419-42006441 GTTTCACCTGAGGGGAAGGATGG + Intronic
1126415952 15:48417516-48417538 CCTGTAGCTGAAGGGAAGGAGGG - Intronic
1126531471 15:49715475-49715497 CCTTCAGCAGAGAGGAAGAAGGG - Intergenic
1126776125 15:52102113-52102135 CCTTAAGATGAGGAAGAGGAGGG - Intergenic
1127375064 15:58376816-58376838 TCTTCAGAAGAAAGGAAGGAAGG + Intronic
1127609059 15:60619597-60619619 CTATGAGATGAGGGGAAGGAGGG - Intronic
1128136358 15:65266521-65266543 CCTGCTGATGTGGGGAAGCAGGG - Intronic
1128526936 15:68418944-68418966 CCCTCAGACGAGAGGAAGTAGGG + Intronic
1129890561 15:79069023-79069045 CCTGTAGGTGAGGGGAAGGATGG - Intronic
1129983389 15:79895267-79895289 CTTTCAGGTGAAGGGAAAGATGG - Intronic
1130217052 15:81981902-81981924 CTTTCAGATGATGGCAAGGTGGG + Intergenic
1130692585 15:86096817-86096839 ACTTCAGAGGAGGGGAAGCTGGG - Intergenic
1131287424 15:91072771-91072793 ACCTCAGATGGGGGGAATGAGGG + Intergenic
1132967816 16:2669052-2669074 CCCTCAGAGGAGAGGAAAGAGGG + Intergenic
1133129059 16:3664934-3664956 CGTTCAGCTGATGGGGAGGAGGG - Exonic
1133220234 16:4316492-4316514 CCTCCAGACGGAGGGAAGGAAGG - Intronic
1133638419 16:7693220-7693242 TGTACAGATGAGGGGAGGGAAGG - Intronic
1135993204 16:27229963-27229985 CCATCAGGGGAGGGGCAGGAGGG + Intronic
1136118155 16:28108834-28108856 TGTTCAGATGAGGGGCAGCAGGG - Intronic
1138220957 16:55250110-55250132 GCTTATGATGAGGGCAAGGAGGG - Intergenic
1138604954 16:58082653-58082675 GCTGAAGATGAGGGGAAGGAAGG - Intergenic
1138756366 16:59490942-59490964 CCTGCAGGGGAGGGGGAGGAAGG - Intergenic
1140869730 16:79095516-79095538 TCTTCAGATGAGGAGATGCAGGG + Intronic
1141110789 16:81269210-81269232 CCTTCAGACGTGGGGGTGGATGG - Intronic
1141263678 16:82476245-82476267 ACTGCAGAGGAGGAGAAGGAGGG - Intergenic
1141352246 16:83308936-83308958 CATTCAGATGAAGGGAAAGAGGG + Intronic
1141523110 16:84594559-84594581 CCTTGACCTGAGGGGGAGGAGGG + Intronic
1141530028 16:84639873-84639895 CCTGCAGATGAGGGAGAGAAGGG - Intergenic
1142742930 17:1941411-1941433 CTCTCAGAGGAGGGGCAGGAGGG - Intronic
1143410199 17:6704056-6704078 CCTGCAGAGGAGGGGCAGGGAGG + Exonic
1144179551 17:12739260-12739282 CAGTCAGATGCGGGGAAGCAGGG + Exonic
1145167030 17:20621689-20621711 CCTCCAGGGGTGGGGAAGGATGG + Intergenic
1145743173 17:27293452-27293474 CCTTCAGGTAAGGTGGAGGAAGG + Intergenic
1146557950 17:33842781-33842803 CATTCAGAGGAGAAGAAGGATGG + Intronic
1147321261 17:39647461-39647483 CCTCCTGATGAGGGGGAGGCAGG - Intronic
1147574149 17:41588950-41588972 CCCTCGGAGGAGGGGGAGGAAGG - Intergenic
1147596894 17:41723426-41723448 ATTTCAGAGGATGGGAAGGAGGG + Exonic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1150009680 17:61492272-61492294 CTTCCATAAGAGGGGAAGGAAGG - Intergenic
1151514085 17:74580969-74580991 CCCTCAGATGATGGGACTGAGGG + Intronic
1152297100 17:79474435-79474457 CCATCCGTTGAGGGAAAGGAGGG - Intronic
1154055246 18:11006639-11006661 CTTGAAGATGATGGGAAGGAGGG - Intronic
1155713535 18:28911690-28911712 CCAACAGATCAGGAGAAGGAAGG - Intergenic
1156375717 18:36513707-36513729 TCTACAGAAGAGGGGAAAGAGGG - Intronic
1157173610 18:45430811-45430833 CCTTCACATGGTGGGAAGAAGGG + Intronic
1157831368 18:50859779-50859801 CCTGCAGAGGAGGAGATGGAAGG - Intergenic
1158334914 18:56405656-56405678 ACTTCAAAAGAAGGGAAGGAAGG + Intergenic
1160783054 19:886370-886392 CTTACAGATGAGGAGACGGAGGG - Intronic
1161578054 19:5065761-5065783 CGTGCAGAGGAGGGGATGGATGG - Intronic
1163149129 19:15400849-15400871 CTTTCAGATGAGGGCACCGAGGG - Exonic
1163369149 19:16892420-16892442 CCTGCAGGTGAGAGGAGGGAAGG - Exonic
1164528549 19:29029590-29029612 CCATCAGCTGTGGGGAGGGAGGG + Intergenic
1165020357 19:32919424-32919446 CCTACAGGTGAGGAGGAGGAAGG + Intronic
1165798818 19:38535238-38535260 ACTTCAGAAGAAGGCAAGGAGGG + Intronic
1165927540 19:39336143-39336165 CTGGCAGATGAGGGGAAGGAAGG - Exonic
1166753118 19:45174282-45174304 CACTCATATGAGGGGAGGGAGGG + Intronic
1167647397 19:50713170-50713192 TCTTCACATGAGGGTCAGGATGG - Intronic
925344052 2:3157369-3157391 CCTTTAGTTTAGGGAAAGGAAGG + Intergenic
925560657 2:5190537-5190559 TTTTCAGATGAGGGGAAAAAGGG + Intergenic
927863122 2:26572795-26572817 GCTTCCGAGGAGGAGAAGGAGGG + Intronic
928245066 2:29619826-29619848 CCTTCTGACAATGGGAAGGATGG + Intronic
929431163 2:41887847-41887869 CAATGAGATGAGGGGAGGGAGGG + Intergenic
930956718 2:57211518-57211540 CCTTCAGAAGAGGTGGAGAAAGG + Intergenic
931017911 2:58006941-58006963 CCTTCTAATGAGGGCAAGGCTGG + Intronic
932119293 2:69083379-69083401 GATTCAGATGGGGCGAAGGAAGG - Intronic
932438640 2:71717873-71717895 CCATCAGGGGAGGGTAAGGAGGG + Intergenic
934580517 2:95434221-95434243 CCTTCAGATGCAGGGAAGGCAGG + Intergenic
934598931 2:95642496-95642518 CCTTCAGATGCAGGGAAGGCAGG - Intergenic
935307837 2:101754870-101754892 TGTGAAGATGAGGGGAAGGAAGG + Intronic
936532277 2:113284490-113284512 CCTTCAGATGCAGGGAAGGCAGG - Intergenic
938118905 2:128620223-128620245 CCTCCAGGACAGGGGAAGGAAGG - Intergenic
938235620 2:129704169-129704191 CTTCCAGAAGAGGAGAAGGAGGG - Intergenic
938826779 2:135013585-135013607 CCAAGGGATGAGGGGAAGGAAGG - Intronic
939589346 2:144044446-144044468 ACTTCAGATGTGGGGAAGCATGG - Intronic
939677320 2:145088473-145088495 GGTTCAGGAGAGGGGAAGGAGGG + Intergenic
940014178 2:149086283-149086305 CTTTCTGATCAGGGGAAGAATGG - Intronic
940890545 2:159031298-159031320 GCTTCAGCTGTGGGGAAGGAAGG + Intronic
941778098 2:169414503-169414525 GCTTAAAATGAGGGAAAGGAAGG + Intergenic
945561848 2:211349243-211349265 GCTTCACATGAGGGGATGGCAGG + Intergenic
946547922 2:220766066-220766088 GCTTAAGATGTGGGGGAGGATGG + Intergenic
947462017 2:230311631-230311653 CCAGAAAATGAGGGGAAGGATGG - Intronic
947471101 2:230401843-230401865 CCAGAAAATGAGGGGAAGGATGG - Intronic
947923794 2:233903298-233903320 CCTTCAAAAGAGGGCAAGAAAGG + Intergenic
948280157 2:236740772-236740794 CCAGCAGGTGAGGGGAGGGACGG + Intergenic
1169509904 20:6252202-6252224 ACTTCTGGAGAGGGGAAGGAGGG + Intergenic
1170006828 20:11678459-11678481 CCTTGAGTGGAGGTGAAGGAGGG - Intergenic
1173282764 20:41643987-41644009 CCATCAGAGGAGAGGGAGGATGG + Intergenic
1173370244 20:42428613-42428635 GCTTCACAGGAGGGGAAGGATGG + Intronic
1173609291 20:44355238-44355260 CCTTGAGATGAAGGGACTGAAGG - Intergenic
1173728176 20:45311392-45311414 CCTTCTGATGAGTTGAATGAGGG + Intronic
1175460070 20:59145877-59145899 TCTTCAGTTGAGGAGGAGGAGGG - Intergenic
1175862148 20:62156296-62156318 CCTTCAGATGAACTGCAGGAAGG - Intronic
1176347202 21:5759861-5759883 CATTCAGATGAGGTTAGGGAGGG - Intergenic
1176354016 21:5880445-5880467 CATTCAGATGAGGTTAGGGAGGG - Intergenic
1176497625 21:7564594-7564616 CATTCAGATGAGGTTAGGGAGGG + Intergenic
1176541523 21:8157931-8157953 CATTCAGATGAGGTTAGGGAGGG - Intergenic
1176560474 21:8340976-8340998 CATTCAGATGAGGTTAGGGAGGG - Intergenic
1176954846 21:15090264-15090286 CCTTCTCTTGAGGGGAGGGAGGG - Intergenic
1177015712 21:15784195-15784217 CCTTCATATTAGAGGACGGAAGG - Intronic
1178076885 21:29020547-29020569 CCTCAAGAGAAGGGGAAGGATGG + Intergenic
1178860195 21:36282579-36282601 CCTTCAGCTGAGGCCAGGGAAGG + Intronic
1181166144 22:20984084-20984106 ACATCAGAGGAGGGGCAGGAAGG - Intronic
1181282244 22:21728236-21728258 CATGGAGAGGAGGGGAAGGAAGG - Intronic
1181481925 22:23205377-23205399 CCGTGAGAGGAGGAGAAGGAGGG - Intronic
1182106304 22:27692233-27692255 CCTTCAGATTGGGGGTGGGAGGG + Intergenic
1182219841 22:28749366-28749388 CCTTCAGATCTGAAGAAGGAGGG - Intronic
1182788727 22:32930666-32930688 GATTCAGATTTGGGGAAGGAGGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183705170 22:39471420-39471442 GCTTCAGGTTAGAGGAAGGAAGG - Intronic
1183806956 22:40219740-40219762 CCTTCGGATAAGGTGAGGGAAGG - Intronic
1183945794 22:41325063-41325085 CAGTTACATGAGGGGAAGGAGGG - Intronic
1183975692 22:41510784-41510806 CCTTCAGATTATAGGCAGGATGG + Intronic
1184326765 22:43793800-43793822 CCTTCAGATGAACCGATGGATGG - Intronic
1203246461 22_KI270733v1_random:74350-74372 CATTCAGATGAGGTTAGGGAGGG - Intergenic
949126252 3:448289-448311 CATTCATATGAAGGGCAGGAAGG - Intergenic
953740853 3:45537896-45537918 CTCTCAGAGGAGGGGAAGGAAGG + Intronic
953981960 3:47417743-47417765 CTTTCAGATGGTGGGAAGGCTGG - Exonic
954175085 3:48838271-48838293 CCTAGGGATGAGGGGAATGAGGG + Intronic
955439222 3:58937497-58937519 CTTTCAAGAGAGGGGAAGGAAGG + Intronic
958994668 3:100890346-100890368 CCTTTAGAGGAAGGGAATGAGGG - Intronic
960256757 3:115518775-115518797 CCTTGATGTGAGGGGAAGGAGGG + Intergenic
961027169 3:123568471-123568493 CTTGAGGATGAGGGGAAGGAAGG - Intronic
961236927 3:125375168-125375190 CCTTGAGAGGAGGGGAAGGGGGG + Exonic
961264982 3:125634522-125634544 CCATCAGGTGAGGGGGAGGGAGG - Intergenic
961646490 3:128395420-128395442 CATTCAGAGGAGGAGGAGGAAGG - Intronic
962251409 3:133838259-133838281 CCTAGAGATGAGGGGAAGGGGGG + Exonic
964743744 3:159992234-159992256 GCTTCTGAGGAGGGGCAGGAAGG - Intronic
966579565 3:181545307-181545329 CCTACAGGTGAGAGCAAGGAGGG - Intergenic
966811984 3:183855128-183855150 CCTAAGGCTGAGGGGAAGGAGGG + Intronic
967666283 3:192176016-192176038 CATTCAGATGAGGGGGCGGTGGG - Intronic
967946010 3:194804834-194804856 CCTTCAGCTGAGGAGGAGCAGGG + Intergenic
968054000 3:195677044-195677066 CCTTCACATTAGGGGGAGGAAGG - Intergenic
968101891 3:195972106-195972128 CCTTCACATTAGGGGGAGGAAGG + Intergenic
968113467 3:196069799-196069821 CCTTCAGATGAAAGGCAGCATGG - Intronic
968286942 3:197514271-197514293 CCTTCGGATGAGGGGGAGAAAGG + Exonic
968641021 4:1714877-1714899 ACTTCAGAGGAGGAGGAGGAGGG - Intergenic
969054306 4:4392154-4392176 CATTGGGATGGGGGGAAGGATGG - Intronic
969175957 4:5399302-5399324 CCTGCAGAGGTGGGGAAGGAGGG - Intronic
970455894 4:16224239-16224261 TCTTAAAAGGAGGGGAAGGAAGG + Intronic
971130355 4:23802341-23802363 TCTTCCTATGGGGGGAAGGAAGG + Exonic
971451483 4:26805505-26805527 CCTGAAGAAGATGGGAAGGATGG - Intergenic
975240161 4:72047794-72047816 AATTCAGATGAGTGGAAAGAAGG - Intronic
975642269 4:76512323-76512345 TCTCCAGAGGAGAGGAAGGAGGG + Intronic
975863552 4:78702951-78702973 CCAACAGATCAGGAGAAGGAAGG + Intergenic
976692366 4:87882646-87882668 CATTAAGATGAGGTCAAGGATGG + Intergenic
976818939 4:89182837-89182859 CCTGGAGATGAGGGGATGGATGG - Intergenic
977788402 4:101068149-101068171 CCTTCAGAAGATGGGAAAGAGGG + Intronic
978190892 4:105910274-105910296 CCTTCAGATGAACTGAAGCAAGG + Intronic
980200694 4:129652401-129652423 CCTGCAGATGAGGGGTCTGACGG + Intergenic
982296801 4:153837197-153837219 AATTCAGGTGAGAGGAAGGAAGG + Intergenic
982634435 4:157875107-157875129 CCTTAAGAACAGAGGAAGGATGG - Intergenic
983092951 4:163526931-163526953 CCTTTAAATGAGGAGAAAGATGG - Exonic
983580648 4:169306397-169306419 CATTTGGAAGAGGGGAAGGAGGG + Intergenic
984820734 4:183879710-183879732 GCTGCTGATGAGTGGAAGGAAGG + Intronic
985128111 4:186715122-186715144 CCTTCTGGTGGGGGGATGGAGGG - Intronic
985737097 5:1590059-1590081 CCTTCACATCAAGGGGAGGAAGG + Intergenic
987717557 5:21592193-21592215 CCCAGAGGTGAGGGGAAGGAGGG - Intergenic
989570887 5:42944995-42945017 CCTGCTGATGAAGGTAAGGACGG + Intergenic
990112884 5:52349749-52349771 CCTTAAGATCAGGTGAAGTAAGG - Intergenic
991419487 5:66426788-66426810 CCTTCAAACGAGGGCCAGGATGG - Intergenic
993824782 5:92669466-92669488 ACTACAGATGAGGGGCAAGATGG + Intergenic
993828147 5:92719489-92719511 CCTTGAGTAGAGGGGAATGATGG - Intergenic
994087845 5:95779810-95779832 GTTTCAGATAAGGGGAAGCATGG + Intronic
994376546 5:99021512-99021534 CTTTCAGTTGAAGGGAAGGATGG - Intergenic
995502531 5:112823354-112823376 CTTTCAGGTGAGGAGCAGGATGG + Intronic
995856814 5:116601168-116601190 CCCTCAGAGGAGGGAGAGGAGGG - Intergenic
997649827 5:135508145-135508167 ACTGCAAAAGAGGGGAAGGAGGG + Intergenic
998408010 5:141885039-141885061 ACTTCAGTTGAAAGGAAGGAAGG - Intergenic
998498599 5:142612747-142612769 CCTGGAGATGAGGAGCAGGAAGG - Intronic
999135111 5:149313546-149313568 CCTTGAGAGGAGGGGCAGCATGG - Intronic
999684261 5:154088425-154088447 CCTTCTGGTGTGGAGAAGGAGGG - Intronic
1000120491 5:158193371-158193393 GCTCCAGAAGTGGGGAAGGAGGG - Intergenic
1001481089 5:172089643-172089665 TCGGCAGATGAAGGGAAGGATGG + Intronic
1001880355 5:175238549-175238571 CCTGCAGTTGAGTGGCAGGAAGG + Intergenic
1004015420 6:11727873-11727895 CCTGAATATGAGGGGAAGGTGGG + Intronic
1004241040 6:13922931-13922953 CCTTCAGCTGAGGGCAGGGATGG + Intergenic
1006133833 6:31883950-31883972 CCTGCAGAAGACGGGAAGAAGGG + Exonic
1007760890 6:44133256-44133278 CCCTCAGATGGAGGGGAGGATGG - Intronic
1008764868 6:54899640-54899662 CCTTCAGATGAGAGAAGGGGCGG + Intronic
1010259249 6:73796298-73796320 GCTCCAGATGAGGCTAAGGAGGG - Intronic
1011642984 6:89432958-89432980 CCTTCTGAAGAGTGGGAGGAAGG - Intergenic
1013042341 6:106448276-106448298 CCTTGAGAGGAGGAGAATGATGG - Intergenic
1014307896 6:119765391-119765413 CATTTGGATAAGGGGAAGGAGGG + Intergenic
1014918887 6:127188976-127188998 TCTACAGATGAGGATAAGGAGGG - Intronic
1015089008 6:129331391-129331413 CCATCAACTGAGGGTAAGGATGG - Intronic
1016372951 6:143393297-143393319 CCTGGAGAGGAGGAGAAGGAAGG + Intergenic
1016616297 6:146052455-146052477 CCTTCCCATGGGGAGAAGGATGG + Intronic
1017569664 6:155731133-155731155 CCTTAGGAACAGGGGAAGGATGG + Intergenic
1018611579 6:165652919-165652941 CCCTGAGTTGATGGGAAGGAGGG - Intronic
1019559558 7:1649178-1649200 CCTGCAGGTGACGGGAAGGGTGG + Intergenic
1019612822 7:1945581-1945603 CCTGGAGATGAAGGGAAGGAGGG + Intronic
1026726173 7:72871406-72871428 CCATCAGATGAGGGGACTGGTGG - Intergenic
1026875994 7:73879435-73879457 CATTCACATATGGGGAAGGAGGG + Intergenic
1027442217 7:78231680-78231702 ACTTCAGGTGTAGGGAAGGAGGG - Intronic
1032063429 7:128744831-128744853 TATTCAGGAGAGGGGAAGGAAGG + Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1034009533 7:147513933-147513955 CCTTCAGATGAGGGGAAGGAGGG - Intronic
1036769031 8:11566145-11566167 CCTGCTCATGAGGTGAAGGAAGG - Intergenic
1038543101 8:28405208-28405230 CCTAAAGCTGAGGTGAAGGAGGG - Intronic
1039079973 8:33724334-33724356 TCCAGAGATGAGGGGAAGGAAGG - Intergenic
1040455507 8:47593858-47593880 CCTTCTGCTGAGGGGTAGGAGGG + Intronic
1040592233 8:48804329-48804351 CCTTCAGAGGAGAGGGAGGGTGG + Intergenic
1040731857 8:50457141-50457163 CCTTCAGATGAGAAAAACGAGGG - Intronic
1040776165 8:51045416-51045438 ACTTCAAATGGGGGGAAGGTGGG - Intergenic
1043197005 8:77307894-77307916 CCTTCTTATGATAGGAAGGAAGG + Intergenic
1044307017 8:90649674-90649696 CCTTTAGATGAGGGTAATCAGGG - Intronic
1044748993 8:95398608-95398630 CCTTCAGAAAAGGGGATGGTGGG - Intergenic
1045686517 8:104718376-104718398 CCTTCAGCTGATGGAAAGGTTGG + Intronic
1045780635 8:105858883-105858905 CCATCAGATGAGAAGAAGTAGGG - Intergenic
1045799640 8:106087505-106087527 CCTTCAGAATAGGAGAAAGATGG + Intergenic
1046802737 8:118447278-118447300 ATTTCAACTGAGGGGAAGGAAGG - Intronic
1047535278 8:125713563-125713585 TCTTCATATGATGGGCAGGAGGG + Intergenic
1049239860 8:141531834-141531856 CCCTCAGAGCAGGGGCAGGAAGG + Intergenic
1049340990 8:142112586-142112608 CCTCCCGATGAGGGTCAGGACGG - Intergenic
1049469791 8:142770187-142770209 CCCTCAGAGGCTGGGAAGGAAGG + Intronic
1049864320 8:144924014-144924036 CATTGAGGTGAGGGGAAGGGCGG + Intergenic
1052020690 9:23522310-23522332 CCTTCAGATGAAGGCAATAAGGG - Intergenic
1052978229 9:34427858-34427880 CCTTCAGGTGAGTTGAAGGAGGG - Intronic
1053124740 9:35571278-35571300 GCTTCAGATGAGGGGAGTGGTGG + Intergenic
1054883642 9:70172306-70172328 CATGAAGATGAGGGGCAGGAGGG - Intronic
1054949774 9:70836736-70836758 TATTCAGATGAGGAAAAGGATGG - Intronic
1055362051 9:75502450-75502472 CCTGCAGATCAGGAGAAGAAAGG - Intergenic
1056781548 9:89554765-89554787 TCTTCAGAAGAGTGGAAAGAAGG + Intergenic
1057091547 9:92262513-92262535 GTTTCAGATGAGGGGAAGAATGG + Intronic
1057221306 9:93259320-93259342 CCGTGTGATGGGGGGAAGGAGGG - Exonic
1057327568 9:94079883-94079905 CCTACAGATGAGGTGGAGCAGGG + Intronic
1057694505 9:97313689-97313711 CCTTCTGATGAAGGGCAGAATGG + Intronic
1057896782 9:98915591-98915613 CCTTGTGGTGAGTGGAAGGACGG - Intergenic
1057915130 9:99049596-99049618 CCTCCAGAGGAAGGAAAGGAGGG - Intronic
1060517378 9:124274321-124274343 ACTTCAGAAGAAGGGAAGGAGGG + Intronic
1061055464 9:128220127-128220149 CCTCAAGAGGAGGGGAAGGGTGG - Intronic
1061270879 9:129541363-129541385 CTTTCTGTTGATGGGAAGGAGGG - Intergenic
1061485814 9:130920021-130920043 CCTGCAGGTGGGCGGAAGGAGGG - Intronic
1061572517 9:131486485-131486507 CCTTCTGATGAAGAGAAGAAAGG + Intronic
1061802950 9:133121975-133121997 CCCTCAGAGGAGGGGAAGCCAGG + Intronic
1062102773 9:134737234-134737256 CCTGCAGCTGCAGGGAAGGAAGG - Intronic
1062358667 9:136177198-136177220 CCATCTGAGGAGGGCAAGGATGG + Intergenic
1203462796 Un_GL000220v1:57422-57444 CATTCAGATGAGGTTAGGGAGGG - Intergenic
1186471014 X:9822286-9822308 CCTGCAGGTTAGGGGAAGGGGGG + Intronic
1187272766 X:17793649-17793671 CCTTCAGTGGAAGGGAAGGATGG + Intergenic
1188162863 X:26823548-26823570 CCTTCAGATGAGAGAAATGAAGG - Intergenic
1189204574 X:39226743-39226765 TCTTCAGAAGACAGGAAGGAGGG + Intergenic
1191927220 X:66326528-66326550 GCTCCAGAGGAAGGGAAGGAGGG + Intergenic
1192769226 X:74169575-74169597 ACTCCAAAAGAGGGGAAGGAGGG + Intergenic
1193909488 X:87284765-87284787 CATTGAGTTGAGTGGAAGGATGG - Intergenic
1195868588 X:109461275-109461297 GCTTCTGATGAAGGGAAGAAAGG + Intronic
1196665542 X:118312026-118312048 CCTTCAGGTGAAGGGAATCATGG - Intergenic
1199503735 X:148538026-148538048 CCTTGAGGGGAGGGGAAGGATGG - Intronic
1200225171 X:154413131-154413153 CCCTGAGATGGGGTGAAGGAAGG + Intronic
1201643498 Y:16202705-16202727 GCTACAGATGAGGTGAAGGCTGG - Intergenic
1201659317 Y:16382616-16382638 GCTACAGATGAGGTGAAGGCTGG + Intergenic