ID: 1034010133

View in Genome Browser
Species Human (GRCh38)
Location 7:147520839-147520861
Sequence GGTCTACGGAAGCTGAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034010133_1034010139 15 Left 1034010133 7:147520839-147520861 CCCATGCTCAGCTTCCGTAGACC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1034010139 7:147520877-147520899 CAGTCACTTCATTTACCCCTAGG 0: 1
1: 0
2: 1
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034010133 Original CRISPR GGTCTACGGAAGCTGAGCAT GGG (reversed) Intronic
900930382 1:5733455-5733477 GGGAGACGGAAGCTGTGCATGGG - Intergenic
902607215 1:17575371-17575393 GGTCTAAGGAAGCTTTGCAGAGG + Intronic
913531106 1:119734961-119734983 GGTCTAGGTAAGCTGGGCACAGG + Intronic
915590919 1:156869812-156869834 GGTCAACGGCAGCTGACAATGGG + Intronic
1063481754 10:6382521-6382543 GGTTTACGGAAGGTGAGGCTGGG + Intergenic
1065893116 10:30137916-30137938 GGTCATCGGAAGCAGAGCAAGGG - Intergenic
1067567449 10:47349277-47349299 GACCTCCGGAAGCTGAGGATAGG + Exonic
1068263900 10:54622342-54622364 GTTCTAGGGAAGCTGAGCGCTGG + Intronic
1071242706 10:83725808-83725830 GGGCTACTGAGGCTGAACATGGG + Intergenic
1075487634 10:122838589-122838611 GATCTAAGGAATCAGAGCATAGG + Intronic
1096430287 12:51537586-51537608 GGTCTAGGGAAACTGTGCTTAGG + Intergenic
1098712805 12:73787020-73787042 GGACTACAGAAGCTGAGAAGGGG + Intergenic
1102229186 12:111250577-111250599 GGCCTTCGGAGGCTGAGCCTTGG + Intronic
1105537435 13:21281000-21281022 GCTCAACAGAAGCTGAGGATTGG - Intergenic
1109579652 13:64311400-64311422 GATCTACTAAAGCTGAACATAGG - Intergenic
1119856885 14:77907754-77907776 GGTCTGGGGAAGCTGGGAATCGG - Intronic
1121927367 14:97940457-97940479 GGTTAACAGAAGCTGAGCAGGGG - Intronic
1125426401 15:39553670-39553692 GGTCTATGGACCCTGAGCCTGGG - Intergenic
1141535586 16:84677628-84677650 TCTCTACGGAAGCTAAGCAGAGG - Intergenic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
1149403710 17:56325604-56325626 GGGCTGCTGAAGCTGTGCATGGG - Intronic
1156782916 18:40873781-40873803 GGCCTTCTGCAGCTGAGCATGGG - Intergenic
1159954725 18:74511143-74511165 GGTTTATGGAAGCTGGGAATTGG - Intronic
1162494699 19:11017199-11017221 TGTCCACGGAAGCTGAGAATGGG - Intronic
929444685 2:41992615-41992637 GGTCTCTGGAAGCTTAGCCTGGG - Intergenic
939262800 2:139832061-139832083 GATCTACGGATGCTGAGAAAGGG + Intergenic
941999431 2:171631418-171631440 GGTTTACGGAAGCAGAACAAAGG - Intergenic
943833195 2:192487830-192487852 GGTCCAGGGAACCGGAGCATCGG - Intergenic
945463386 2:210138552-210138574 TGTCTAAGGAAGCTTAACATTGG + Intronic
948169164 2:235887418-235887440 GGTCTACAGAGGCTGGACATGGG - Intronic
1178095160 21:29207075-29207097 GGCCTATGAAAGCAGAGCATTGG + Intronic
953621270 3:44534948-44534970 GGTCCAGGGGACCTGAGCATCGG - Intergenic
997128524 5:131253207-131253229 GGTGTACGGGAGGTGAGCTTGGG + Intronic
997662284 5:135598833-135598855 GGTTTACGGACGCTGCGCACAGG - Intergenic
1001749883 5:174120784-174120806 GGGCTCAGGAAGCTGAGCCTGGG - Intronic
1002062070 5:176630946-176630968 GGTCTCGGGAAGCTTACCATGGG + Exonic
1002308975 5:178302811-178302833 GTTCTAAGCAAGCTGTGCATAGG + Intronic
1002516652 5:179763966-179763988 TGTGTTTGGAAGCTGAGCATAGG + Intronic
1007689538 6:43690810-43690832 CTTCTACTAAAGCTGAGCATAGG - Intergenic
1015664640 6:135615351-135615373 GGTCTAGGACAGCTGAGCAAGGG - Intergenic
1018704975 6:166457417-166457439 TTTCTAAGGAAGCTGAGAATGGG + Intronic
1019121816 6:169810338-169810360 TGCCTAGGGAAGCTGAGCTTAGG + Intergenic
1019269779 7:140365-140387 GGTCTTTGGGTGCTGAGCATGGG + Intergenic
1020781352 7:12519779-12519801 GGGCTACGGAGGCACAGCATTGG - Intergenic
1022666593 7:32416639-32416661 GGTGTAGGGAAGGTGAGCATGGG + Intergenic
1026426320 7:70297957-70297979 GCTCTAAGAAAGCTGAGCAAAGG - Intronic
1030968814 7:116027647-116027669 CATCTAAGGAAGCTGAGCATTGG + Intronic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1037328299 8:17717263-17717285 GTTCTAGGGAAGGTGAGAATTGG - Intronic
1040024206 8:42766742-42766764 GGTCCAGGGAAGAAGAGCATTGG + Intronic
1041183263 8:55270990-55271012 GAGCTAGGGAGGCTGAGCATGGG + Intronic
1043107912 8:76138187-76138209 GGTGTACAGAAGCTGAGGATGGG - Intergenic
1046668444 8:117031822-117031844 AGCCTACAGAAGCTTAGCATTGG - Intronic
1053397144 9:37785376-37785398 GATCTCTGGAAGCTGAGCAGAGG + Intronic
1196483946 X:116182108-116182130 GGGCTTGGGAAGCTGAGCACAGG + Intergenic
1201062067 Y:10055119-10055141 GGTCTAGGGGACCAGAGCATTGG - Intergenic
1202271008 Y:23073886-23073908 GGGCGAAGGATGCTGAGCATGGG + Intergenic
1202295018 Y:23346796-23346818 GGGCGAAGGATGCTGAGCATGGG - Intergenic
1202424003 Y:24707630-24707652 GGGCGAAGGATGCTGAGCATGGG + Intergenic
1202446786 Y:24962455-24962477 GGGCGAAGGATGCTGAGCATGGG - Intergenic