ID: 1034010139

View in Genome Browser
Species Human (GRCh38)
Location 7:147520877-147520899
Sequence CAGTCACTTCATTTACCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034010136_1034010139 -6 Left 1034010136 7:147520860-147520882 CCCTGTCCTCTGTCAGTCAGTCA 0: 1
1: 1
2: 3
3: 25
4: 235
Right 1034010139 7:147520877-147520899 CAGTCACTTCATTTACCCCTAGG 0: 1
1: 0
2: 1
3: 14
4: 146
1034010134_1034010139 14 Left 1034010134 7:147520840-147520862 CCATGCTCAGCTTCCGTAGACCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1034010139 7:147520877-147520899 CAGTCACTTCATTTACCCCTAGG 0: 1
1: 0
2: 1
3: 14
4: 146
1034010137_1034010139 -7 Left 1034010137 7:147520861-147520883 CCTGTCCTCTGTCAGTCAGTCAC 0: 1
1: 0
2: 2
3: 17
4: 202
Right 1034010139 7:147520877-147520899 CAGTCACTTCATTTACCCCTAGG 0: 1
1: 0
2: 1
3: 14
4: 146
1034010133_1034010139 15 Left 1034010133 7:147520839-147520861 CCCATGCTCAGCTTCCGTAGACC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1034010139 7:147520877-147520899 CAGTCACTTCATTTACCCCTAGG 0: 1
1: 0
2: 1
3: 14
4: 146
1034010135_1034010139 1 Left 1034010135 7:147520853-147520875 CCGTAGACCCTGTCCTCTGTCAG 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1034010139 7:147520877-147520899 CAGTCACTTCATTTACCCCTAGG 0: 1
1: 0
2: 1
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034010139 Original CRISPR CAGTCACTTCATTTACCCCT AGG Intronic
900823670 1:4909542-4909564 CAGTCACTTCATGGACGCATAGG - Intergenic
902394291 1:16124198-16124220 CAGACACGTCACTTAACCCTGGG - Intergenic
907455085 1:54570438-54570460 CAGTCACAGCACTTACCCTTGGG + Intronic
909551813 1:76906361-76906383 CTGCCACTTCATTTCCCCCATGG - Intronic
909563491 1:77030042-77030064 AAGTCTCTTCATTAACCTCTTGG + Intronic
909798728 1:79778619-79778641 CAGTGACTTCATTTGAGCCTCGG - Intergenic
913708373 1:121452066-121452088 CAGTCAGTTCTTGTACCCATGGG + Intergenic
916817797 1:168370543-168370565 TAGCAACTTCATTTACTCCTGGG - Intergenic
921394600 1:214655290-214655312 CAACAACTTCATTTTCCCCTGGG - Exonic
923234479 1:232019320-232019342 CCGTCCCATCATTTAACCCTAGG - Intronic
923802675 1:237225667-237225689 CATTCACTCCCTTTACCCCCAGG - Intronic
924774793 1:247108552-247108574 CAGTCTCTTCATCTGCCCCCAGG - Intergenic
1065413276 10:25454621-25454643 CAGTGATTTCATTTACACCTGGG + Intronic
1065438849 10:25728547-25728569 CAGTCATTTCATCTGCTCCTTGG - Intergenic
1070039466 10:72761123-72761145 CAGTCACTTCATTAACTCTCTGG - Intronic
1071384513 10:85105879-85105901 CAGCCACTGCATTTAGCCCAAGG + Intergenic
1075972284 10:126664942-126664964 CAGCCATTTCATTTCCCTCTTGG + Intronic
1078501517 11:11883838-11883860 CAGTCACTTCCATACCCCCTGGG + Intronic
1078783045 11:14458249-14458271 TAGTCACTAGATTTACACCTTGG + Intronic
1080666728 11:34342865-34342887 TATTCACTTCATTTACCAGTGGG + Intronic
1081164520 11:39791281-39791303 CAACCACTTCATTTAACACTTGG + Intergenic
1083782144 11:64924261-64924283 CAGACACTTCAGAAACCCCTTGG - Intronic
1087435454 11:98111695-98111717 CAGTCACTGCATTAAGCACTGGG - Intergenic
1087703160 11:101460211-101460233 AAGTCAGTACATGTACCCCTTGG + Intronic
1089714281 11:120341623-120341645 GAGTCCCTTCAATTACCTCTGGG - Intronic
1090027481 11:123180186-123180208 CATTTACTTCATTTACTTCTGGG - Intronic
1092766970 12:11861657-11861679 AAGAGACTTCCTTTACCCCTAGG + Intronic
1093061121 12:14606122-14606144 CATTCACTTCTTTTTCCCTTTGG + Intergenic
1094113336 12:26884108-26884130 CAGTCACTGCATTCAACCCTGGG + Intergenic
1095719534 12:45385695-45385717 TACTCACTTCATTTCCCCTTGGG + Intronic
1099709175 12:86198301-86198323 CAGTCATTTGTTTTTCCCCTGGG + Intronic
1101076636 12:101136413-101136435 CATTCACTCCCTTTAGCCCTAGG - Intergenic
1101221696 12:102647975-102647997 GGGTAACTTCATTTACCTCTAGG + Intergenic
1105838204 13:24229444-24229466 GAGTAACTTCATCTGCCCCTGGG + Intronic
1106479437 13:30125780-30125802 CAGTCACTTCTCCCACCCCTAGG + Intergenic
1108023651 13:46155637-46155659 AAGTCACTTCACTTACAACTTGG + Intronic
1108256658 13:48617884-48617906 CATTCTCTTCATGTACCCCATGG - Intergenic
1108563409 13:51669989-51670011 CAGGCACTTCACTCACCCTTTGG + Intronic
1109127029 13:58530656-58530678 CAGTCACTTCATTTCCAGCAGGG - Intergenic
1110125291 13:71934568-71934590 CAATCAATCCATTTACCCTTAGG + Intergenic
1110431749 13:75432271-75432293 CAGTTAATACATTTATCCCTTGG - Intronic
1112540300 13:100304320-100304342 CAATCACTTTATCTACTCCTTGG - Intronic
1118435032 14:65763296-65763318 CACTCACTTCATTTTCCCCCAGG + Intergenic
1120256404 14:82124893-82124915 CAGTTAATTCACATACCCCTGGG - Intergenic
1121502769 14:94451484-94451506 CAGGCACTTCATTTTACCCAGGG - Intronic
1121574547 14:94972941-94972963 CAGTGACATCATCTCCCCCTTGG - Intergenic
1122158068 14:99762755-99762777 CAGTCACTGCACTTCGCCCTAGG + Intronic
1125728656 15:41880946-41880968 CAGTCACTGCCTTGTCCCCTGGG + Intronic
1128614366 15:69097794-69097816 CAGTCACTTCTTTTAGGCATTGG - Intergenic
1129181707 15:73881978-73882000 CAGCCACTCCTCTTACCCCTGGG + Intronic
1130860401 15:87881108-87881130 CAGTCACTTCCTTTTCCCCTTGG - Intronic
1133184350 16:4084983-4085005 CTGTCTCTCCATTTACCCATTGG + Intronic
1133282675 16:4676142-4676164 CAGCCTCTTCACTTACTCCTGGG - Intronic
1133416956 16:5614276-5614298 CAGAAACTTCATTTCCCCCTAGG + Intergenic
1136466121 16:30445298-30445320 CACGGACTTCTTTTACCCCTTGG - Exonic
1137513380 16:49120801-49120823 GAGTCACTTCATTTGCCCTAAGG + Intergenic
1139733986 16:68971593-68971615 CAAACAATTCATTTACCCTTAGG + Intronic
1140782739 16:78311432-78311454 CTGTCACTTCCTTCACCCCCAGG + Intronic
1141231544 16:82171613-82171635 CAATGATTTTATTTACCCCTGGG - Intergenic
1147717659 17:42519198-42519220 CAGTCACCTTATCTACCCATGGG - Intronic
1148913141 17:50954075-50954097 AAGTCACTGCCTTCACCCCTGGG + Intergenic
1149461193 17:56831589-56831611 GACTCATTTCATTCACCCCTTGG - Intronic
1149546793 17:57509949-57509971 CAGTCACTGCATTTGCCCATTGG + Intronic
1151077642 17:71292493-71292515 CAGTAACTTCATTAACCTGTAGG + Intergenic
1151135205 17:71939991-71940013 CAATCACTTGATTTGGCCCTGGG - Intergenic
1152258493 17:79254070-79254092 CAGTGACTTCATTTGCACCATGG - Intronic
1153444118 18:5153054-5153076 AATTCACTTCCTTTTCCCCTTGG - Intronic
1157721685 18:49930100-49930122 AAGTCACTTCATGTCCCCTTGGG + Intronic
1158352204 18:56574263-56574285 CAGTTACTACATTCAGCCCTTGG + Intergenic
1160990514 19:1858493-1858515 CAGGCACTTCATTGACGGCTGGG + Intronic
1162698527 19:12495926-12495948 CAGTCTCTTCTTTTTCCCCAGGG + Intronic
1165193529 19:34083234-34083256 CAGGCACTTGATTTCCCCCAAGG + Intergenic
926585435 2:14680685-14680707 CAGCCACTTCTCTTGCCCCTGGG - Intergenic
926950458 2:18237070-18237092 CAGACACTTCAGATAACCCTAGG - Intronic
933419571 2:82028778-82028800 TAGTCTCTTCATTTGCCCCCAGG - Intergenic
935307574 2:101752213-101752235 TTGTGACTTCATTTACCCTTGGG - Intronic
935902655 2:107809204-107809226 CTGTGACCTCATGTACCCCTTGG + Intergenic
935986304 2:108676476-108676498 CAGTCATTTCATTTGGCCATAGG - Intronic
936138750 2:109920124-109920146 CAGTCATTTCATTTGGCCATAGG - Intergenic
936205946 2:110451361-110451383 CAGTCATTTCATTTGGCCATAGG + Intronic
937275180 2:120679526-120679548 CTGTCTCTTCATTCTCCCCTCGG - Intergenic
938573041 2:132579870-132579892 CAGCCACCTCATTTTCCTCTTGG - Intronic
941078296 2:161031300-161031322 CAGTGACTTCCTTTATCCTTAGG - Intergenic
941845939 2:170133166-170133188 TAATTTCTTCATTTACCCCTTGG - Intergenic
942670248 2:178367661-178367683 CAGTAACTTCTTTTACGCATTGG + Intronic
942803816 2:179906313-179906335 CAGGCACTTCCTTTGGCCCTTGG + Intergenic
944418747 2:199505780-199505802 AAGTGACTTCCTTTACCCCATGG + Intergenic
945398886 2:209355305-209355327 CTGTCACTTTATTTATCCGTGGG + Intergenic
1169572502 20:6922074-6922096 CAGTTTCTTCATTTTTCCCTGGG + Intergenic
1170326327 20:15157982-15158004 AATTCTCTTCAGTTACCCCTTGG + Intronic
1171247747 20:23626286-23626308 CAGTCACTGCATTTTGCCCAAGG - Intergenic
1173175543 20:40762170-40762192 CAGTCAGGTCATTTAGCCCATGG - Intergenic
1173315974 20:41943245-41943267 CATACAGTTCATTTCCCCCTTGG - Intergenic
1174596991 20:51692091-51692113 CAGTAACTACATTCCCCCCTTGG - Intronic
1176159011 20:63639203-63639225 CACTCACCCCATTCACCCCTGGG - Intergenic
1178411528 21:32367412-32367434 CAGTCTCCACATTTACCCTTGGG - Intronic
1179550823 21:42142334-42142356 CAGCCCCTTCATCTGCCCCTGGG - Exonic
1182477767 22:30585460-30585482 CAGACTCTTCATTTACAACTGGG + Intronic
1183774647 22:39955971-39955993 CAGTCACTACAGTTATCCATGGG + Intronic
1184521261 22:44995694-44995716 CAGTCACTGCATTTAGCACTCGG + Intronic
954047459 3:47945021-47945043 CACTCCCTCCATTTAACCCTAGG - Intronic
955955233 3:64281914-64281936 TATTCTCTTCATTTTCCCCTTGG - Intronic
956720596 3:72114169-72114191 CAGTGACTTCATGTAGCCATTGG + Intergenic
959004894 3:101008796-101008818 CAGTCACATTTTTTACTCCTAGG + Intergenic
960700835 3:120437887-120437909 AAGTCACTTGATTTAACCATTGG + Intronic
961983171 3:131103587-131103609 CCTTCACTGCATTTACTCCTGGG + Intronic
963355748 3:144207493-144207515 CAGAGACTTGATATACCCCTGGG + Intergenic
964358209 3:155869929-155869951 CAGTCCCTCCACCTACCCCTTGG - Intergenic
965732894 3:171791559-171791581 TAATCACTTCATTTTCCCCTTGG - Intronic
966719379 3:183046201-183046223 CAGTCCCTTCACTAAACCCTGGG + Intronic
971413295 4:26398286-26398308 CACTCCCTCCACTTACCCCTTGG + Intronic
971801885 4:31303607-31303629 CAGCCACTCCATTTAGCTCTTGG - Intergenic
973552134 4:52046755-52046777 CAGTCATTTCATGTACATCTTGG - Intergenic
974355255 4:60804197-60804219 CAGTGACTTCATATTCCCCTAGG - Intergenic
974390847 4:61265433-61265455 CAGTTACTTCCTATATCCCTGGG + Intronic
975458758 4:74625759-74625781 CAGTCACTTTATTTTCTCTTTGG - Intergenic
976253668 4:83078817-83078839 CATTCACTTCAGTTATCCCTAGG - Intergenic
978403571 4:108356343-108356365 CAGTAACTTCATTTAATCATTGG + Intergenic
978877252 4:113656640-113656662 CAGTCACTCCCTTTCCCCCATGG + Intronic
979501978 4:121451201-121451223 CAGTGATTTCATTTACCTCCTGG - Intergenic
986520373 5:8610195-8610217 CTAACACTTCATTTAGCCCTGGG - Intergenic
987142555 5:14960512-14960534 CACGGACTTCTTTTACCCCTTGG + Intergenic
987752004 5:22052074-22052096 TACACACTTCATTTACCCCTTGG + Intronic
989615276 5:43332183-43332205 CAGACATTTCTTTTACACCTTGG - Intergenic
989998769 5:50867572-50867594 CAGTCACTTCACTTACCCACTGG - Intergenic
991474832 5:67008194-67008216 AAGTCTCTTCATTTATGCCTAGG - Intronic
992878135 5:81077827-81077849 CAGCCTCTTTATTTACCTCTAGG - Intronic
992886717 5:81166916-81166938 CATTCTTTTCCTTTACCCCTGGG - Intronic
994009585 5:94885337-94885359 CCTTCATTTCATTTTCCCCTGGG - Intronic
996114930 5:119607669-119607691 CTTTGACATCATTTACCCCTAGG + Intronic
998500762 5:142630630-142630652 CAGCCACTGCATGTACCCTTGGG + Intronic
998983826 5:147733421-147733443 CAGGCACTTCACTCACCCTTTGG + Intronic
999832804 5:155336911-155336933 CAGCCATCTCCTTTACCCCTAGG - Intergenic
1005968064 6:30741704-30741726 CTGTCCCTTCTTTTTCCCCTAGG - Exonic
1007080933 6:39103383-39103405 CAGTGACTGCATCTACCTCTGGG + Intergenic
1010423767 6:75703834-75703856 CTGTCACTTCTGTCACCCCTAGG + Intronic
1014594568 6:123318379-123318401 CAGTCACTTCATCTACCAAATGG - Intronic
1020863601 7:13526625-13526647 CATTAACATCATTTACCCCTGGG + Intergenic
1022606847 7:31823882-31823904 CAGTCACTTCTTTAACCACTTGG - Intronic
1032275679 7:130453312-130453334 CAGTCAGTTTATATACCCCAGGG + Intergenic
1033160574 7:138992599-138992621 CTGTCACTGCATTTACCACATGG + Intergenic
1034010139 7:147520877-147520899 CAGTCACTTCATTTACCCCTAGG + Intronic
1034153187 7:148933104-148933126 CAGTCACGTCATTTACTCTATGG - Intergenic
1035923725 8:3705504-3705526 CTGTCACTTCTTTTACTCCCAGG + Intronic
1036492397 8:9239898-9239920 CAGTCAATGCAGTTACCCTTTGG + Intergenic
1039158774 8:34593964-34593986 CAGTCACTTCAATGTCCCATTGG - Intergenic
1041610191 8:59837074-59837096 CATTCAGTTCATTTTACCCTTGG - Intergenic
1041657825 8:60371358-60371380 CAATCCCTTCTTTTGCCCCTTGG - Intergenic
1042071286 8:64937841-64937863 CAGTGACTCCATATATCCCTTGG + Intergenic
1042661963 8:71164239-71164261 CATTTACTTCTTTTTCCCCTTGG - Intergenic
1043244938 8:77986738-77986760 CAGTCAATTCATTTTTCCATAGG - Intergenic
1043625546 8:82253416-82253438 CAGTGACTACAGTTGCCCCTTGG - Intergenic
1050116379 9:2267760-2267782 CAGTAACTGAATCTACCCCTGGG + Intergenic
1050699206 9:8318488-8318510 CAGTCATTTCAGCTACCCTTTGG + Intronic
1056829156 9:89900398-89900420 CAGGCACTTCGTTAAACCCTGGG + Intergenic
1187278078 X:17833841-17833863 CAGGCATGTCATTTAACCCTGGG + Intronic
1189221324 X:39374831-39374853 CAGTGACTTCCTTTTCCCCATGG - Intergenic
1193783879 X:85735337-85735359 CAGTGCCTTCATGTACCCCTAGG - Intergenic
1195595739 X:106686668-106686690 CAGTTTCTTCATTGACCCATGGG - Intergenic
1195995667 X:110729340-110729362 CCATCACTTCTTTTTCCCCTGGG + Intronic
1198938353 X:141924023-141924045 CAATCACTTCATTTACAGGTGGG + Intergenic
1201447939 Y:14078999-14079021 CGATCACCTCATTTCCCCCTGGG + Intergenic