ID: 1034020608

View in Genome Browser
Species Human (GRCh38)
Location 7:147637769-147637791
Sequence GATTGTGTATTTTCATCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034020608 Original CRISPR GATTGTGTATTTTCATCCAA AGG Intronic
905051963 1:35059559-35059581 GAATATGTATTTGCATGCAAGGG + Intergenic
908286389 1:62608233-62608255 GATTTTGGATTTTGTTCCAAAGG - Intronic
908769022 1:67579431-67579453 AATATTGTATATTCATCCAATGG - Intergenic
908990711 1:70085231-70085253 CCTTTTGTATTTTCATCAAAGGG + Intronic
909094742 1:71272760-71272782 GAATGTGGATTTTAATCCACTGG + Intergenic
909442485 1:75713436-75713458 GATTTTGTATTTAACTCCAAAGG + Intergenic
911495453 1:98625768-98625790 GATTGAGTATGGTTATCCAAAGG - Intergenic
911982874 1:104587465-104587487 GAATGTCTCTTTTCCTCCAAAGG + Intergenic
912105655 1:106270420-106270442 GATTCTCTATTTTCTTCCATTGG + Intergenic
914789246 1:150862223-150862245 CATTGTGTATCTTCATGCACAGG + Intronic
915041939 1:152975535-152975557 AATTGTGAATTTTCATACAATGG + Intergenic
915233762 1:154465409-154465431 GTTTGTGTTTTATCATCCACAGG - Exonic
916369762 1:164079025-164079047 AATTGTCTTTTTTCATCTAATGG + Intergenic
917655422 1:177120979-177121001 CATGGAGTATTTTCATCCTAGGG + Intronic
917772849 1:178299131-178299153 AATGGTATATTTTCTTCCAAAGG - Intronic
918578427 1:186094514-186094536 GAGAATGTATTTTCTTCCAAGGG + Intronic
919236523 1:194851802-194851824 GATTGTATTTTTTCATGCTATGG + Intergenic
920444817 1:206007897-206007919 GATTTTATTTTTTCAACCAAAGG - Intergenic
921355871 1:214283672-214283694 GAACGTGTATTTTCCTCCATAGG + Intronic
922118671 1:222640432-222640454 GATTTTCTATTTTGTTCCAATGG - Intronic
924140136 1:241013450-241013472 GACTATGTCTTTTCTTCCAAAGG + Intronic
1063131050 10:3177260-3177282 AATTATGTATTTTCATCCTCTGG + Intergenic
1063142787 10:3270406-3270428 GACTGTATAATTTGATCCAATGG + Intergenic
1064765647 10:18668691-18668713 AATTTTGAATTTTAATCCAAAGG + Intronic
1066178753 10:32939114-32939136 GATTGTGGATTTTAAGCCTAGGG - Intronic
1066214055 10:33268399-33268421 GCTTTTTAATTTTCATCCAAAGG - Intronic
1068029958 10:51693831-51693853 GAAGGTGAATTTTCAACCAAAGG + Intronic
1068138562 10:52975452-52975474 GTTTGCATATTTTCATACAAAGG - Intergenic
1068285323 10:54926158-54926180 GAATGTTGAATTTCATCCAAAGG + Intronic
1068366908 10:56063321-56063343 GATTCTGTATTTTATTCCATTGG + Intergenic
1070651150 10:78237366-78237388 AACTGTGTATGTTCATCCCACGG + Intergenic
1071221174 10:83466211-83466233 GTTTGTTTATTTTCTTTCAATGG - Intergenic
1071918353 10:90321861-90321883 GATTGTCTTTATTGATCCAAGGG - Intergenic
1073388744 10:103153321-103153343 GATCCTGTATTCTCATCCAGAGG - Intronic
1073392527 10:103191638-103191660 GATGGTAAATTTTCATACAATGG + Intronic
1076607925 10:131701456-131701478 GATTGTCCTTTGTCATCCAAGGG - Intergenic
1078402402 11:11039784-11039806 AATTGTTTATTTTCAACCAGGGG + Intergenic
1079527777 11:21411381-21411403 GAGTGTTTGTTTTCATGCAATGG + Intronic
1079701167 11:23550686-23550708 GATTGTCTTTTTTCATTCATTGG + Intergenic
1080354979 11:31432874-31432896 AACTGTGTACTTTCAACCAAAGG + Intronic
1085973773 11:81625884-81625906 TAGTATGTATTTGCATCCAAGGG - Intergenic
1086480025 11:87224583-87224605 AGTTCAGTATTTTCATCCAAAGG - Intronic
1087354734 11:97078028-97078050 GATTGAGATTTTTTATCCAAAGG + Intergenic
1088688679 11:112306078-112306100 AATTTTGTATTTTCATCCTTGGG + Intergenic
1089636175 11:119813636-119813658 AATTGTGTATAGTCATACAAAGG - Intergenic
1089931048 11:122312484-122312506 AATTATGTATTTAAATCCAAGGG + Intergenic
1090528188 11:127560361-127560383 GCATGTGTACTTGCATCCAAGGG + Intergenic
1091698702 12:2645393-2645415 AATTCTGAATTTACATCCAAAGG + Intronic
1095062951 12:37724253-37724275 AAGTGTGTATTTTCAGCCATGGG + Intergenic
1096898887 12:54853920-54853942 GATTTTGAATTTTTATACAATGG + Intronic
1097502660 12:60425372-60425394 GGTTGTGTTTTTTCACTCAAAGG + Intergenic
1098048135 12:66423510-66423532 GCTAGTGTATTCTCATTCAAAGG - Intronic
1099492175 12:83300830-83300852 GAATGTCTCTTTTCCTCCAAAGG + Intergenic
1100101892 12:91118576-91118598 TATTGTGTTTTGACATCCAAGGG + Intergenic
1100888608 12:99099635-99099657 TATTTTGTGTTTTTATCCAAAGG - Intronic
1102847098 12:116197159-116197181 GCTGCTGTATTTTCATCCACCGG - Intronic
1106925115 13:34605682-34605704 ACTTGTGTATTTTCATGCATAGG - Intergenic
1110893366 13:80717470-80717492 GCATGTGTATTTTTATCCAGAGG - Intergenic
1111700181 13:91676912-91676934 GATTGTGTACTTGGTTCCAACGG - Intronic
1112440970 13:99424766-99424788 AATTGTGGATTTTAACCCAATGG - Intergenic
1113337882 13:109394204-109394226 GATTGTCCATTTTTATCCAGCGG + Intergenic
1113810299 13:113137518-113137540 GATAGTGTATTTGCTTCCTAGGG + Intronic
1114590568 14:23860903-23860925 GGTTGTGAGTTTTCATCCAGGGG - Intergenic
1115534555 14:34360675-34360697 AATGGTGTATTTACAACCAATGG + Intronic
1115878427 14:37888193-37888215 GTCTGTGTATTTTCATAAAAGGG + Intronic
1115933207 14:38521570-38521592 AATTGTGACTTTTCATGCAAGGG - Intergenic
1116207964 14:41892549-41892571 GACTGTATATTTTCTTTCAATGG + Intronic
1116472674 14:45304655-45304677 GAGTGTTTATTTACCTCCAAAGG - Intergenic
1116826070 14:49674912-49674934 GCTTGTGCATTTTCATCTCAAGG + Intronic
1117688023 14:58275641-58275663 GATAGTGTTTTTTCAACAAATGG + Intronic
1120209196 14:81618106-81618128 GATACAGTATTTTAATCCAAGGG - Intergenic
1120802610 14:88709034-88709056 TAATGTGTATTTTCACACAAGGG + Intronic
1121981931 14:98461918-98461940 GATTGTCTCTTTTCAGGCAAGGG - Intergenic
1124407685 15:29406173-29406195 TATTTTGTATTTTTATACAATGG - Intronic
1127207597 15:56736445-56736467 GTTAATGTATTTTCATTCAAAGG + Intronic
1127302856 15:57674353-57674375 GAATGTGAATTTTAATCCCAAGG + Intronic
1127543831 15:59970515-59970537 GCTAGTGGATTTTGATCCAAGGG + Intergenic
1128210144 15:65892928-65892950 GATTATGTATTTTCTTCCCTGGG - Intergenic
1131316610 15:91344246-91344268 GTTTGTGCATTTTCATCCTCAGG + Intergenic
1134873227 16:17671259-17671281 ATTTGTGTATTTACATCTAAAGG + Intergenic
1136609543 16:31357722-31357744 GAGGATCTATTTTCATCCAATGG + Intronic
1137828222 16:51517859-51517881 GAATGTGTCTTCTCCTCCAAAGG + Intergenic
1139158389 16:64472788-64472810 GATTTTCTATTTTCTTCCATTGG - Intergenic
1143845248 17:9768907-9768929 GATTGTGGTTTTTCATTCATAGG + Intergenic
1145855315 17:28150906-28150928 TATAGTTTATCTTCATCCAATGG + Intronic
1147021932 17:37541609-37541631 GATAATGTCTTTTAATCCAAAGG - Intronic
1147035401 17:37676196-37676218 GAATGTGTTTATTCTTCCAAGGG + Intergenic
1148985552 17:51617781-51617803 TTTTGTGTATTTTCTTGCAAAGG + Intergenic
1149760767 17:59227708-59227730 AATTGTGTATTTATAACCAATGG - Intronic
1150538371 17:66070043-66070065 AATTGTGTATTTTTTGCCAAAGG - Intronic
1153445956 18:5173500-5173522 GACTGTGTTTTTTCCTCCAAAGG - Intronic
1154272858 18:12934813-12934835 GATTGTGTAATTTCATGTACAGG + Intergenic
1156626752 18:38919315-38919337 GAATGTCTATTCTCCTCCAAAGG - Intergenic
1157036035 18:43975389-43975411 CATTGTTTAATTTAATCCAATGG - Intergenic
1157280909 18:46345745-46345767 AATTCTGTATTTGCATTCAAAGG - Intronic
1157465967 18:47945315-47945337 GATTGTGTAACTTGATCCATTGG + Intergenic
1163436448 19:17298618-17298640 GATTGTGTAGTTGCATCCAGTGG + Intronic
1163706788 19:18819094-18819116 GACGGTGTATTTTCTTACAAGGG + Intergenic
1164936574 19:32219556-32219578 GATTGTGTCTCTTCCTCCTAAGG - Intergenic
1166350148 19:42193890-42193912 CATTGTGTATATTCATACAATGG + Intronic
1167404633 19:49297090-49297112 AATTATGTCTTTTCATCAAAAGG + Intronic
926565476 2:14465281-14465303 ATTTGAGTATTTTCATGCAAGGG + Intergenic
926841251 2:17083037-17083059 CATTGTGTAATTTCAGACAAAGG - Intergenic
926877831 2:17503728-17503750 ATTTGTGTATTTTCATCAATAGG - Intergenic
930440016 2:51392591-51392613 GAATGTGTCTTCTCCTCCAAAGG + Intergenic
930457609 2:51625867-51625889 GACTGTGTTTTTCCCTCCAAGGG + Intergenic
930814539 2:55580600-55580622 AATTTTGTCTTTTCATCCAGTGG - Intronic
931008158 2:57876717-57876739 GAATGTGTATTTTCTTCCCTAGG - Intergenic
931602966 2:64021779-64021801 CAATGTGTATTTTCTTCCTATGG - Intergenic
932052786 2:68415946-68415968 AATTATGTATATTCATACAATGG + Intergenic
932174673 2:69588768-69588790 CATTATTTATTTTTATCCAATGG + Intronic
933159880 2:79011793-79011815 AAATGTGTATCTTCAACCAAAGG + Intergenic
935670247 2:105549414-105549436 GATTGTCTTTTTTCAACAAATGG - Intergenic
937549446 2:123068914-123068936 GGTTTTGTATTTTCAAACAAAGG - Intergenic
938712451 2:133987206-133987228 GATTGTGTATTTTTCTGTAAAGG - Intergenic
938985194 2:136568515-136568537 AATTGTTTATTTTTATCAAAAGG + Intergenic
939064821 2:137470427-137470449 GTTTGTTTGTTTTCATCCACGGG - Intronic
939659968 2:144877077-144877099 GATTTAGTTTTATCATCCAATGG + Intergenic
940860450 2:158765332-158765354 GGTTGTGTCTCTTCCTCCAAAGG - Intergenic
941665274 2:168238519-168238541 GATTGTGTATTTTGATATATGGG - Intronic
943154446 2:184155532-184155554 GATGGTGTGTTTTAATACAATGG + Intergenic
944532559 2:200681549-200681571 GCTGGAGCATTTTCATCCAAGGG + Intergenic
944620205 2:201506496-201506518 AATTGTGTAATTTCCTCCACAGG + Intronic
945712734 2:213319567-213319589 GATTTTGTATATTCATCTAATGG + Intronic
947916685 2:233836870-233836892 GACTGTTTATTTTCCTTCAAGGG + Exonic
948004865 2:234599511-234599533 GAATGTGTGCTTCCATCCAAAGG - Intergenic
948729629 2:239954619-239954641 AATTGTGTGTGTTCATCCAATGG - Intronic
1169960221 20:11151846-11151868 GAATGTGTCTTCTCCTCCAAAGG - Intergenic
1170116690 20:12867852-12867874 GAGTGTATATTTTCACCAAAAGG + Intergenic
1170118799 20:12890512-12890534 AATTGTGGATGTTCATGCAATGG + Intergenic
1173722863 20:45274798-45274820 GATTGTGGATATTCATATAATGG - Intergenic
1174220470 20:48950413-48950435 GAATATGTATTTTCTTTCAATGG - Intronic
1174285517 20:49470082-49470104 GGTTGTGTATATTCATTCAGTGG - Intronic
1174740461 20:53008507-53008529 GATTGGATATTTTCAGCAAAGGG + Intronic
1177342865 21:19827282-19827304 TATTGAGTATATTCATCAAAAGG + Intergenic
1177628231 21:23692429-23692451 GATTGTGTATTTGCTTTAAATGG - Intergenic
1177724412 21:24948642-24948664 GATTTTGTATCTACTTCCAAGGG - Intergenic
1182958083 22:34446123-34446145 GATTGTGTTTCTTCCACCAAAGG - Intergenic
951118476 3:18894033-18894055 TATTGTGTATTTTCAGCAAATGG + Intergenic
951156358 3:19358556-19358578 TATTGTTTATTTTCACCCAATGG - Intronic
952076012 3:29698787-29698809 AAATGTGTAATTACATCCAATGG - Intronic
952528769 3:34241774-34241796 GATGTTATATATTCATCCAAGGG + Intergenic
955766235 3:62347021-62347043 CATTGTGTATTTTCAGCCACAGG - Intergenic
956324696 3:68038877-68038899 GAGTGTTTATTTTCATAAAAAGG + Intronic
956737198 3:72246990-72247012 GAGTCTGTATATTCATCCAAAGG - Intergenic
956958775 3:74373712-74373734 TAATGTTTATTTTAATCCAAAGG + Intronic
957839624 3:85651749-85651771 GATTATGTATTGTAAACCAAGGG - Intronic
957895720 3:86419142-86419164 GACTGTGTGTCTTCTTCCAATGG - Intergenic
959407347 3:105976730-105976752 GATAGTATCTTTTCATCCACTGG + Intergenic
961183781 3:124897089-124897111 GATTGTGTTTCTTCCTCCAAAGG + Intronic
961986183 3:131137580-131137602 GTGTCAGTATTTTCATCCAATGG + Intronic
962608890 3:137056193-137056215 GATGCTGTGTTTTCATCCTAAGG - Intergenic
963347665 3:144115194-144115216 GTTTGTGCATTTTCAATCAATGG - Intergenic
965042139 3:163522391-163522413 GATTAAGTATTTTGATCTAAAGG - Intergenic
971034239 4:22675755-22675777 GATTGTGTATTTACATCAATAGG - Intergenic
972741976 4:41895573-41895595 ATTTGTGTAATTTCATACAAGGG - Intergenic
973884351 4:55305624-55305646 GATAGTTTATTTTCTTCTAATGG - Intergenic
977521570 4:98090823-98090845 GATTGTGTAATTTAATGCAAAGG + Intronic
979818161 4:125136135-125136157 GATTGTGTATAATCTTTCAATGG + Intergenic
979998581 4:127463208-127463230 GAATGTGTCTTCTCCTCCAAAGG - Intergenic
980259969 4:130435664-130435686 AATTGTATATTATCATCTAATGG + Intergenic
980286578 4:130785836-130785858 GATACTGTATTTTACTCCAAAGG + Intergenic
980785687 4:137551222-137551244 AAGTGTGTATTTTCATCAAGAGG - Intergenic
981666100 4:147228720-147228742 GATTGTGCATTTTTATCCACTGG + Intergenic
983035265 4:162857141-162857163 GATGTTGATTTTTCATCCAAGGG + Intergenic
983446240 4:167856661-167856683 AATTCTGAATTTTCATCAAAAGG - Intergenic
983467542 4:168113577-168113599 GATTATGTACTTTTATACAAGGG - Intronic
983767564 4:171504390-171504412 GATTATGTATTTGGATCCATTGG - Intergenic
983859418 4:172686744-172686766 GAATGTGTTTTTTCCTTCAAAGG + Intronic
984369117 4:178839082-178839104 ATTTGTGTATTTTCTTCCTACGG + Intergenic
985864778 5:2506146-2506168 CACAGTGTATTTTCATCAAAAGG - Intergenic
986281505 5:6326830-6326852 GACTTTGTATTTTAATCAAATGG - Intergenic
987153555 5:15064589-15064611 GTTGGTCTATTTTTATCCAATGG - Intergenic
987649170 5:20718665-20718687 GAGTGTGTACTTACTTCCAAAGG - Intergenic
988746387 5:34142874-34142896 GAGTGTGTACTTACTTCCAAAGG + Intergenic
990932331 5:61107032-61107054 GTGTGTGTATATTTATCCAAAGG - Intronic
993366634 5:87042091-87042113 GAGTGTGTCTTCTCCTCCAATGG - Intergenic
994075895 5:95649376-95649398 AAATGTGTATGTTCATTCAATGG - Intronic
994135215 5:96278609-96278631 GATTGCTTATTTCCATCCAGGGG + Intergenic
994894378 5:105683655-105683677 GTTTGTGTATTTTCATCTCCTGG + Intergenic
994967080 5:106687268-106687290 AATTGTGTTTATTCATACAATGG - Intergenic
995533085 5:113110167-113110189 GAATGTGTATTTGCTACCAAAGG - Intronic
996275496 5:121660982-121661004 GAGTGTGTCTTCTCCTCCAAAGG + Intergenic
997225557 5:132207273-132207295 TATTGGGTCTTCTCATCCAAGGG - Intronic
997707624 5:135973227-135973249 GATTGCCTATTTGCACCCAATGG - Intergenic
998305674 5:141074077-141074099 AATTGTATATTTTCTTCCAAAGG + Intergenic
1003201149 6:3961899-3961921 AATTGTATATATTCATACAATGG + Intergenic
1003751609 6:9064926-9064948 CATTATATATTTTCATTCAAAGG - Intergenic
1004129170 6:12902521-12902543 GATGTTGTATGTTCATCCAATGG - Intronic
1005544534 6:26851112-26851134 GAGTGTGTACTTACTTCCAAAGG + Intergenic
1006996601 6:38267020-38267042 GATTGTATATATTCATCAAGAGG - Intronic
1007150535 6:39686098-39686120 TTTTGTTTATTTTCATCAAAAGG - Intronic
1008560836 6:52723126-52723148 GATTGTTTATTTGCATCTATTGG + Intergenic
1010962263 6:82158744-82158766 TATTGTACATTTTCATCCATAGG + Intergenic
1012004487 6:93695387-93695409 GATTGTGTAGTTTCAACATAAGG + Intergenic
1013361584 6:109398317-109398339 GAAAGTGTATTTTCATCCATAGG - Intronic
1013946184 6:115725590-115725612 GATTATTTATTTTCATCCACTGG + Intergenic
1014905929 6:127027118-127027140 GATAGAGTATTTTCTTCCAATGG - Intergenic
1015023408 6:128504383-128504405 GATAGAGTACTTTCAGCCAATGG + Intronic
1017133060 6:151124414-151124436 GATTGTGTAAGTACATCCTACGG + Intergenic
1017954314 6:159166204-159166226 GAGTGTGTGTTTTAATCAAAAGG - Intergenic
1018126700 6:160689778-160689800 TATTGTGCATTTTAACCCAAAGG - Intergenic
1018149853 6:160927313-160927335 TATTGTGCATTTTAACCCAAAGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1020862359 7:13510525-13510547 GATTTTGTAGTTTCATCAATTGG - Intergenic
1021980728 7:26052819-26052841 CATTGTCTCTTCTCATCCAAAGG + Intergenic
1024587187 7:50852022-50852044 GATTGTGTGTTGTGATCTAATGG + Intergenic
1028458710 7:91067209-91067231 AATTATGTTTTTTCATCTAATGG + Intronic
1028810989 7:95085888-95085910 TCTTGTGTAATTTCATCTAAAGG + Intronic
1030392731 7:108947055-108947077 AATTATGTCTTTTCAGCCAAAGG - Intergenic
1030477469 7:110054657-110054679 GGTTATCTATTTTCATCCATTGG + Intergenic
1030704031 7:112672652-112672674 AATTGTGACTATTCATCCAATGG - Intergenic
1031325591 7:120393138-120393160 GAGTTTGTTTTTTTATCCAATGG + Intronic
1031332127 7:120478919-120478941 GATTATGTATTTTTACACAAAGG + Intronic
1031334183 7:120506055-120506077 GATTGTGTTTTTTCCTTAAATGG - Intronic
1033570823 7:142626844-142626866 GATTGTTTATGCTCATCGAAGGG + Intergenic
1033931042 7:146522238-146522260 GATTGTGAATTTCCATACAGAGG + Intronic
1034020608 7:147637769-147637791 GATTGTGTATTTTCATCCAAAGG + Intronic
1034132204 7:148730039-148730061 TACTGTATATTTTCATCTAATGG + Exonic
1034702319 7:153107183-153107205 AATTGTTTATATTCATGCAATGG - Intergenic
1036744521 8:11395424-11395446 GAATGTCTTTTTTCATCCACAGG - Intronic
1040005382 8:42616572-42616594 GTTTGCATATTTTCATCTAAAGG - Intergenic
1043433693 8:80218352-80218374 CTTTGTGTATATTCATACAATGG + Intronic
1044174304 8:89098871-89098893 TATTGTTTATTTTCCTCCATTGG - Intergenic
1045685866 8:104711586-104711608 TATTGTGTATATTCATATAATGG + Intronic
1047652384 8:126936954-126936976 GAATGTCTATTTTCATCCAAGGG - Intergenic
1047663490 8:127064543-127064565 GGGTGTGCATTTTCATGCAAGGG + Intergenic
1049950431 9:638570-638592 CAATGTGTTTTTTCAACCAAAGG + Intronic
1052883131 9:33617955-33617977 GATTGTTTATGCTCATCGAAGGG + Intergenic
1052954106 9:34239469-34239491 GAGTTTGTATTGTCATGCAAAGG - Intronic
1053333397 9:37237586-37237608 TATTTTGTATTTTCACACAATGG + Intronic
1054598731 9:67096911-67096933 GATTGTGTATATTCAGCTACAGG + Intergenic
1055199308 9:73639729-73639751 TATTGTGTATTTTCATTTAGAGG - Intergenic
1055888248 9:81092177-81092199 AATTGTGTATATTCTTACAATGG + Intergenic
1058171915 9:101692122-101692144 TCTTGTCTATTTTCATACAATGG + Intronic
1058524315 9:105841604-105841626 AACTATGTATTTTCATGCAATGG + Intergenic
1058728300 9:107824700-107824722 AATTCTGTATTTTCCCCCAAAGG + Intergenic
1059266539 9:113037491-113037513 GATTGTCTATTTTCTTGAAATGG + Intergenic
1059831322 9:118099644-118099666 GATTGTGTCTTCTCAGCCCAGGG + Intergenic
1188321904 X:28749260-28749282 TATTGGGTATATACATCCAAAGG - Intronic
1188598261 X:31928041-31928063 GATTGCGTATATACATACAATGG + Intronic
1188660233 X:32750008-32750030 GCGTCTGTTTTTTCATCCAATGG - Intronic
1188694481 X:33173361-33173383 GTTTATGTATTTTCATCAAAAGG + Intronic
1189858182 X:45244940-45244962 GATTGTCTATTTTGTTCCATTGG + Intergenic
1190154803 X:47981465-47981487 GATTTTGTAGCATCATCCAAAGG - Intronic
1191201587 X:57788460-57788482 GGTTGTGTATTTTGTTCCATTGG - Intergenic
1192054953 X:67764060-67764082 GATGGTGTAATTTCAATCAATGG + Intergenic
1192289701 X:69781104-69781126 AATGTTGTATTTTCATACAATGG - Intronic
1192965290 X:76170860-76170882 GATGTTGTATTTACATACAACGG + Intergenic
1196506451 X:116450039-116450061 TATTCTGTATTTTCTTCTAAAGG - Intronic
1197390881 X:125862470-125862492 GATTGTGTATTTGCATTATAAGG - Intergenic
1198082051 X:133249387-133249409 AATTGTGCCTTTTAATCCAAAGG + Intergenic
1199068981 X:143454214-143454236 AATGATGTATTTTTATCCAACGG + Intergenic