ID: 1034020756

View in Genome Browser
Species Human (GRCh38)
Location 7:147639754-147639776
Sequence CTAGACTTCTTGAGACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034020756_1034020758 1 Left 1034020756 7:147639754-147639776 CCTGTTTGTCTCAAGAAGTCTAG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1034020758 7:147639778-147639800 CTGATTTTTTGTTTTCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034020756 Original CRISPR CTAGACTTCTTGAGACAAAC AGG (reversed) Intronic
901640515 1:10690781-10690803 CTTCTCTTCTTGAGACAAAGGGG - Intronic
902113293 1:14100685-14100707 CTAGACTTCCAGAAAGAAACAGG + Intergenic
902682363 1:18052299-18052321 CTTGACATCTTGAGTCACACTGG - Intergenic
904980831 1:34499939-34499961 ATAAACTTGTTGAGACAAATAGG + Intergenic
905005068 1:34703033-34703055 CTAGTCTTCTTGGGAGAAATTGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
909725638 1:78831788-78831810 CTAGCCTTCTTAAGGCAGACTGG + Intergenic
913669373 1:121081437-121081459 CTGGGCTTCCTGAGTCAAACAGG - Intergenic
914021128 1:143868834-143868856 CTGGGCTTCCTGAGTCAAACAGG - Intergenic
914659617 1:149776759-149776781 CTGGGCTTCCTGAGTCAAACGGG - Intergenic
916222287 1:162457054-162457076 TAAGACTTCTAGAGAAAAACAGG + Intergenic
916997267 1:170314536-170314558 TTAGACTCATTGAGTCAAACAGG + Intergenic
918227816 1:182502115-182502137 CTAGACTTATCGAGAAAAAAAGG - Intronic
918299256 1:183187419-183187441 CAAGACTTTTTTAGACAAAAAGG - Intronic
919364734 1:196643727-196643749 CTAGTATTCTTGGGTCAAACAGG + Intergenic
919897200 1:202016371-202016393 CTAGACATCTTGAGAACATCAGG - Intronic
921266718 1:213426539-213426561 CTAAAATTTTTGAGACCAACTGG + Intergenic
1063174181 10:3536638-3536660 GTAGCCTTCTTGACACAAGCAGG + Intergenic
1063275300 10:4560252-4560274 AAAGACTTCTTCAGACAAATAGG - Intergenic
1070643572 10:78186060-78186082 CAAGACTTATAGAGACCAACTGG + Intergenic
1070949041 10:80416219-80416241 CTAAAGTTCTTGGGACAAACAGG - Intronic
1071084609 10:81855191-81855213 CTAGGCTTCTTGTGCCAAAGAGG - Intergenic
1071284352 10:84130464-84130486 CTAGACTTCTTTAGATTTACTGG - Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1081881987 11:46461258-46461280 ATAAACTTGTTGAGACAAATGGG + Intronic
1081883286 11:46472345-46472367 CTGAACTACTTGAGACAAGCTGG - Intronic
1085914332 11:80866946-80866968 CCAGACTTCTAAAGAGAAACAGG + Intergenic
1088420731 11:109643183-109643205 GTAGTCATCTTGAGACCAACAGG - Intergenic
1090868493 11:130722841-130722863 CTAGAATTCTAGAGTCATACGGG - Intergenic
1090879572 11:130821719-130821741 CTAGACTTCTGGAGAATAAGAGG + Intergenic
1094344099 12:29447905-29447927 TGAGGCTTCTTGATACAAACAGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1099673835 12:85731265-85731287 TTAGAGTTCTTCAGAGAAACAGG + Intergenic
1101022075 12:100563572-100563594 CAAGATTTCTTGAGTGAAACTGG - Intronic
1102720328 12:115010461-115010483 CTTGCCTTCTTAATACAAACAGG + Intergenic
1104079672 12:125419170-125419192 ATAGACTTCTTCAAAAAAACAGG + Intronic
1104594702 12:130113220-130113242 CTAGACTTCATTAGAAAGACAGG - Intergenic
1107407242 13:40126416-40126438 CTAGATATCTTGAGACTAAGTGG - Intergenic
1107746330 13:43514108-43514130 GTTCACTTCTTGAGACAAAGAGG + Intronic
1107750754 13:43563631-43563653 CTAGATTAATTGAGAAAAACAGG + Intronic
1107883864 13:44857763-44857785 CTTGACTTCTGAAGACATACAGG + Intergenic
1111042656 13:82770369-82770391 CTAGACATCTTGGGCCAAAAGGG - Intergenic
1114334007 14:21668899-21668921 CTAAACTTCTTGAGAGAATATGG + Intergenic
1114802408 14:25792397-25792419 CTAGACTTCATGAGTCAAGGAGG - Intergenic
1115476106 14:33814378-33814400 CTAGATCTCTGGAGAGAAACTGG + Intergenic
1116766398 14:49075743-49075765 CTAGAATTTGTGAGAAAAACAGG + Intergenic
1118877125 14:69795096-69795118 CTAGGATTCTTGGGACACACAGG + Intronic
1121298587 14:92850810-92850832 CTAGACCTCATGAGCCAAAAAGG + Intergenic
1124949269 15:34301510-34301532 CTAGACTTGTTGGGAAAAATTGG - Intronic
1125512896 15:40302401-40302423 CTGGACTTCCTGAGAGACACAGG - Intronic
1126245800 15:46503651-46503673 CTAGTATTCTTGGGGCAAACGGG + Intergenic
1127376348 15:58388650-58388672 CCAGACTTTTTGGAACAAACAGG - Intronic
1132529559 16:439153-439175 CAAAAGTTCTTGAGACTAACAGG + Intronic
1133951237 16:10394913-10394935 CTAGACCTTTTAAGAAAAACTGG + Intronic
1138321658 16:56119253-56119275 CTTAAATTCTTGAGATAAACCGG - Intergenic
1138731827 16:59204082-59204104 CAAGACTGGTTGAGACAAGCTGG + Intergenic
1139186170 16:64808612-64808634 CTTAAGTTCTTGAGCCAAACAGG - Intergenic
1140156232 16:72429556-72429578 CTACAGCTCTTGGGACAAACAGG + Intergenic
1145791048 17:27626990-27627012 CTAGACTTCTGGAGAGATTCTGG - Intronic
1152670797 17:81604648-81604670 CTTGACTTCTGGAGAAAGACAGG - Exonic
1154273771 18:12942188-12942210 CTAAAATCCTTGGGACAAACTGG + Intergenic
1156341214 18:36212178-36212200 CCAGACATTTTGAGACAGACAGG + Intronic
1157135523 18:45050571-45050593 ATAGTCTTCATGAGACAATCAGG + Intronic
1157556659 18:48617424-48617446 CTAGACTCCTGGAGAGTAACTGG + Intronic
928139559 2:28716763-28716785 CTTGATTTCTTGTGTCAAACTGG - Intergenic
930476501 2:51888807-51888829 CTTGCCTTCTTGGGTCAAACTGG - Intergenic
932077873 2:68681990-68682012 CTGGAAATCTTGAGAAAAACGGG + Intronic
932129688 2:69176870-69176892 TAAGCCTTCTTGAGTCAAACCGG + Intronic
933849618 2:86355407-86355429 CTTGACCTCTGCAGACAAACTGG + Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
938177966 2:129153467-129153489 CTAGACACCTTGAGCCAAAAGGG - Intergenic
940713363 2:157189489-157189511 ATACACTTCTTGAGAGAGACAGG - Intergenic
945526421 2:210893425-210893447 GTAGAGTTCTTTAGACTAACTGG - Intergenic
946520696 2:220461227-220461249 CTGGACGTCTTGAAACAAAATGG + Intergenic
948606709 2:239140616-239140638 CTAGAGTTCTCGAGGCAAATGGG - Intronic
1178006997 21:28233438-28233460 CTAGACTGCCTGAGAGGAACTGG - Intergenic
1178726932 21:35061607-35061629 CTAGATTTCATGTGACAGACAGG - Intronic
1179032500 21:37732728-37732750 CTAGAATTCTTAAGAGAAGCGGG - Intronic
1179240169 21:39583168-39583190 CTAGTCTTCTTTTGACAGACTGG - Intronic
1180623651 22:17179495-17179517 CAAGGCTTCCTGAGAGAAACAGG + Exonic
1181340068 22:22171705-22171727 CTGGACCTGTTGAGAAAAACAGG - Intergenic
949496755 3:4639587-4639609 CTAGACTTTTTGCAATAAACTGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951959614 3:28302052-28302074 CTAGACTTCTGGAATCAAAAAGG - Intronic
952508036 3:34025308-34025330 CTAGACTTCTTGACCCAGAGTGG - Intergenic
956611784 3:71131215-71131237 CTAGGCATCTGGAGATAAACAGG - Intronic
960584268 3:119306225-119306247 TTGGACTCCTTGAGACAAAATGG + Intronic
960869048 3:122230856-122230878 CTAGACTTCTTCAGCCAAAGGGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
971629169 4:28967152-28967174 TTAGACTTCCTGAGAGAAACTGG + Intergenic
973087204 4:46079882-46079904 CTAGAGTTTATGAGACAAAATGG - Intronic
981077895 4:140608883-140608905 CTAGATTTGGTGAGACAAAGAGG - Intergenic
983881369 4:172936973-172936995 CTAGAGTGCTTGAGATAAACTGG + Intronic
984172578 4:176378643-176378665 CGAGATTTGTTGAGAAAAACTGG - Intergenic
984496464 4:180504229-180504251 CAAGACATCATCAGACAAACTGG + Intergenic
986719458 5:10550646-10550668 CTAGAGTTCAGAAGACAAACTGG - Intergenic
987648117 5:20702685-20702707 TTATACTTCTTGAGATAAAAAGG + Intergenic
989225161 5:39018867-39018889 AGAGGCCTCTTGAGACAAACAGG + Intronic
989232470 5:39102009-39102031 CTTGACTTCATGAGTGAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
991182830 5:63774253-63774275 ATAGGCTTCTTCAGAGAAACAGG - Intergenic
991275767 5:64844546-64844568 CTTGACTTCTCAAGTCAAACTGG - Intronic
998420546 5:141981068-141981090 TTAGTCTTCTTCAGACTAACAGG + Intronic
1007444271 6:41893762-41893784 CAAGATTTCTTGAGAGAAAGAGG + Intronic
1008014398 6:46502212-46502234 TTAAACTTCTTGAGAAAAATTGG - Intergenic
1010730682 6:79387603-79387625 CTGGACTTCTTGAGGCAATTGGG + Intergenic
1014037394 6:116782844-116782866 CTAGATATCTGGAGACAAATTGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019075355 6:169382906-169382928 CTTGGCTTCCTGAGACAGACAGG + Intergenic
1020883574 7:13794353-13794375 CTAGAATTTTTGAAACCAACAGG - Intergenic
1022166915 7:27775774-27775796 CAAGACATCTTGAGACTATCAGG + Intronic
1022210125 7:28200555-28200577 CTAGAGTTCTTCAGAAAAACAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1030942173 7:115666433-115666455 CTAGAATTTTTGAGACAAGTTGG - Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1034020756 7:147639754-147639776 CTAGACTTCTTGAGACAAACAGG - Intronic
1038354190 8:26811500-26811522 CTAGCTTTCTAAAGACAAACTGG + Intronic
1041755939 8:61313256-61313278 GGAGACTGCTTGAGACAAAAGGG + Intronic
1044901374 8:96949017-96949039 TTAGACTTAGTGAGACATACAGG - Intronic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1052243395 9:26302845-26302867 CTAAATTTCTTGAGAAATACAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1058880694 9:109283692-109283714 ATAGACTGCTTGATAAAAACAGG + Intronic
1188098485 X:26052126-26052148 CAAGACTTCTAGAGAAAAAAAGG + Intergenic
1189488311 X:41449756-41449778 CCAGACTTCTTGTGACAAGTTGG + Intronic
1190828121 X:54036416-54036438 CTATACTTCATGGGTCAAACAGG + Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1201919830 Y:19222269-19222291 CTGGACTTCTTGGGTCAAATAGG + Intergenic