ID: 1034025876

View in Genome Browser
Species Human (GRCh38)
Location 7:147703205-147703227
Sequence TGTTCTAATTAGAGTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034025876_1034025878 6 Left 1034025876 7:147703205-147703227 CCCAGATCACTCTAATTAGAACA 0: 1
1: 0
2: 0
3: 17
4: 184
Right 1034025878 7:147703234-147703256 AAACTGACAACTAAAGCAAGTGG 0: 1
1: 0
2: 0
3: 27
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034025876 Original CRISPR TGTTCTAATTAGAGTGATCT GGG (reversed) Intronic
900019107 1:175145-175167 TGTTAGAATTAGAGACATCTGGG + Intergenic
900049364 1:533732-533754 TGTTAGAATTAGAGACATCTGGG + Intergenic
900071597 1:775539-775561 TGTTAGAATTAGAGACATCTGGG + Intergenic
905758210 1:40530537-40530559 TGTACTAATTAAAAGGATCTAGG - Intergenic
906897689 1:49795573-49795595 TCTTCTAATTAGAATCATCTTGG - Intronic
909063614 1:70906590-70906612 TGTTGTAAATTGTGTGATCTTGG + Intronic
910140737 1:84024800-84024822 TATTAGAATTAGAGTAATCTTGG - Intergenic
916575015 1:166059410-166059432 TTTTCACATTAGAGTCATCTGGG + Intronic
916702304 1:167310084-167310106 TTTTCTTATTAGAATGGTCTAGG + Intronic
916982935 1:170158672-170158694 AATTCTAATTAGCTTGATCTTGG + Intronic
917208207 1:172600755-172600777 TGCTTTAGTTAGAGTGATCTTGG + Intronic
917723829 1:177811557-177811579 AGTTCTAATGAGAGTCCTCTGGG - Intergenic
922266525 1:223989498-223989520 TGTTAGAATTAGAGACATCTGGG + Intergenic
922428525 1:225522787-225522809 TGTTCTAATTAGAATAATATGGG - Intronic
923407267 1:233674366-233674388 TGTCATAAATGGAGTGATCTGGG - Intergenic
924349154 1:243098635-243098657 TGTTAGAATTAGAGACATCTGGG + Intergenic
1063409023 10:5822542-5822564 TGTGTTAATTAAAGTGATTTTGG + Intronic
1063495927 10:6508058-6508080 AATTCTAATTACACTGATCTGGG + Intronic
1064225731 10:13482997-13483019 TGTTCTAAATGAACTGATCTTGG + Intronic
1064309287 10:14197659-14197681 TGTCATAACTAGAGTGATCCTGG - Intronic
1065564429 10:26994665-26994687 TGTCCAATTTAGAGTGACCTGGG + Intronic
1065663387 10:28030536-28030558 TAATCAAATTAGAGTAATCTGGG - Intergenic
1066977568 10:42383487-42383509 TTTTCTAATTAGTCTTATCTAGG - Intergenic
1067011488 10:42718104-42718126 TGTTATAAAAGGAGTGATCTAGG - Intergenic
1067312091 10:45123723-45123745 TGTTATAAAAGGAGTGATCTAGG + Intergenic
1070278021 10:75026402-75026424 AGTTCTGAATAGAGTCATCTTGG - Intronic
1071887429 10:89966377-89966399 TGTTCTAATGAGGATGCTCTTGG + Intergenic
1073395481 10:103213701-103213723 TGTTGTAACAAGAGTCATCTTGG + Intergenic
1076939075 10:133589691-133589713 TGCTCTAATTAGATAGAACTTGG - Intergenic
1076975708 11:170332-170354 TGTTAGAATTAGAGACATCTGGG + Intronic
1079980334 11:27144363-27144385 TGTTATAATTTGAGTAATTTGGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083040788 11:59684089-59684111 TTTTGTAATTAGAGTAATGTTGG - Intergenic
1085422478 11:76375252-76375274 TGCTCTGATTAGAGTGAGATGGG - Intronic
1088043280 11:105415472-105415494 TTTTCTAATTAGAGTAATTTAGG - Intergenic
1088645960 11:111916574-111916596 TGTTCAAAATAAAGTTATCTGGG - Intronic
1093699598 12:22203911-22203933 GGTTCTGATGAGAGTGATCCAGG + Intronic
1098455091 12:70663711-70663733 TGTTTTATTTTGAGTGCTCTTGG + Intronic
1100304892 12:93341263-93341285 CCTACTAATTAGAGTGATATGGG + Intergenic
1100906337 12:99304321-99304343 TGTTTTAAATAGAGGGACCTGGG + Intronic
1101533037 12:105591935-105591957 TGTTCAAATGATAGAGATCTCGG - Intergenic
1105714242 13:23046315-23046337 TGTATTAATTCGTGTGATCTTGG - Intergenic
1108503952 13:51092437-51092459 TGGTTTATTTAAAGTGATCTAGG + Intergenic
1115252927 14:31368425-31368447 TTTTCTATTTGGAGTGAGCTAGG - Intronic
1116771899 14:49136017-49136039 TGTTCTAATGAGAATGGCCTTGG - Intergenic
1119081249 14:71696316-71696338 TGTTCTAACTAGTGTGAAATGGG - Intronic
1120449261 14:84645320-84645342 TACTCTAATTAGAGTTAACTGGG - Intergenic
1126739259 15:51761127-51761149 TGATCCAATTATAGTGTTCTGGG + Intronic
1127462941 15:59216242-59216264 TGTTATTATGTGAGTGATCTAGG - Intronic
1130758500 15:86792290-86792312 TGTTCTAATTTGATTAATCTGGG + Intronic
1130819580 15:87480226-87480248 TTTTGTAATTAGAGTGACTTAGG + Intergenic
1131799147 15:96051990-96052012 TGTACTCATTAGAGAGATTTTGG + Intergenic
1135197194 16:20404297-20404319 GGTTCTAATTTAATTGATCTGGG + Intronic
1135516426 16:23139349-23139371 TGGTGTGATTAGCGTGATCTCGG - Intronic
1136079540 16:27842654-27842676 TGTTCTACTTAAAGGGATCGGGG + Intronic
1139104546 16:63811974-63811996 TCTGATCATTAGAGTGATCTAGG - Intergenic
1139790690 16:69431924-69431946 TAATTTAATAAGAGTGATCTGGG + Intronic
1142444550 16:90127328-90127350 TGTTAGAATTAGAGACATCTGGG - Intergenic
1142462961 17:108144-108166 TGTTAGAATTAGAGACATCTGGG + Intergenic
1144420702 17:15095469-15095491 TGTTCAAATTAGAGGAAGCTGGG - Intergenic
1147655360 17:42087224-42087246 TTTTTTAATTAGCATGATCTAGG - Intergenic
1149388706 17:56168801-56168823 TGTTCCAATTAGGGTGATGTTGG - Intronic
1150208434 17:63427213-63427235 TGTACTAATTAAAATCATCTTGG - Exonic
1150553260 17:66230601-66230623 TGCTCTCATTTGGGTGATCTTGG + Intronic
1150988110 17:70222531-70222553 TGTTTTAAGTAGCGTGATTTTGG - Intergenic
1151304737 17:73256092-73256114 TCTACTAATTGGAGTTATCTGGG + Intronic
1153586721 18:6628870-6628892 TTGTATAATTAGAGTGATTTTGG - Intergenic
1153632663 18:7086921-7086943 TTTTCTAAATAGAGAGATCATGG - Intronic
1155433452 18:25786390-25786412 TGTTCTAATTTCAGTGAATTGGG - Intergenic
1156306416 18:35881809-35881831 TCTTCTAATTAGAATAATTTTGG + Intergenic
1156996310 18:43471947-43471969 TGTTCTCATTTGTGTGGTCTTGG - Intergenic
1157897466 18:51482749-51482771 TAGTCTAATTAGACTAATCTTGG - Intergenic
1158045184 18:53146993-53147015 TGTTCTATTTAGAGTGACCAGGG + Intronic
1160652678 19:240577-240599 TGTTAGAATTAGAGACATCTGGG + Intergenic
1164251477 19:23480879-23480901 TATTCTAATTCAAGAGATCTGGG + Intergenic
1165799663 19:38541173-38541195 GGTTCTAATTCAATTGATCTGGG + Intronic
1167911320 19:52704299-52704321 TGTTCTGCATGGAGTGATCTTGG + Exonic
1168241235 19:55089892-55089914 TGTTTTGAATAGAGTGGTCTAGG - Intergenic
926441434 2:12892863-12892885 TGTTTTTATGAGAGTGATTTGGG - Intergenic
926685010 2:15691526-15691548 TGTGCCATTTAGAGTGACCTTGG + Intronic
927161822 2:20270616-20270638 TGTTCTAAAGAGTATGATCTTGG + Intronic
928524618 2:32127166-32127188 TGTTTTGTTTTGAGTGATCTGGG + Intronic
929986228 2:46735529-46735551 TGAAATAATTAGAGTGCTCTGGG - Intronic
930512491 2:52362813-52362835 TTTTCTTATTAGAGTCATCATGG + Intergenic
931354838 2:61527564-61527586 TTTTGTATTTAGAGAGATCTTGG - Intronic
931602991 2:64022294-64022316 TGTTCTAATTAGAGGGAGAATGG + Intergenic
931745289 2:65286596-65286618 TGTTCTGATTCAAGTGGTCTGGG - Intergenic
932796819 2:74703180-74703202 GTTTTTAAGTAGAGTGATCTGGG + Intergenic
933411611 2:81932676-81932698 TATTCTAATAAGAGTTATGTAGG - Intergenic
933551044 2:83775859-83775881 TGTGCTAATTAGTTTGATCATGG - Intergenic
934936406 2:98469093-98469115 TGTGCTAATTAGTGTAATCCTGG + Intronic
935066980 2:99657862-99657884 TGTTATCAACAGAGTGATCTGGG + Intronic
936691465 2:114894341-114894363 TGTTTTAATTAGAGTTACTTAGG - Intronic
936715313 2:115180521-115180543 TCTTCTAATTACGGTGATATAGG + Intronic
937039654 2:118811038-118811060 TGTTTTACTTAGAGTGTACTTGG + Intergenic
937517015 2:122666815-122666837 TGTTCTACTTAGAGTGACCAAGG + Intergenic
938176375 2:129134946-129134968 TGTTCTTACTGCAGTGATCTTGG + Intergenic
940108503 2:150125194-150125216 TGTTCTGATTAAAGTGGGCTTGG + Intergenic
941600513 2:167537534-167537556 TGTTCTATTTACAGAAATCTGGG - Intergenic
943121264 2:183739069-183739091 TGTTGGAATTATAGAGATCTTGG + Intergenic
943996049 2:194766931-194766953 TGTTGTAATTACGGGGATCTTGG - Intergenic
944008696 2:194944431-194944453 TTTTCCAATTTGAGTGATGTAGG + Intergenic
946323623 2:218970049-218970071 TGTTTTCATTAGGTTGATCTGGG + Intergenic
947508517 2:230728932-230728954 TGTTTTACTTAGAATGTTCTTGG - Intronic
948430402 2:237914985-237915007 TTTTTTGATTAGAGTGCTCTGGG - Intergenic
948540989 2:238691369-238691391 TTTTCTGCTTAGAGGGATCTGGG - Intergenic
1169621847 20:7515711-7515733 TGTCCTAGGTAGAGAGATCTAGG - Intergenic
1169638743 20:7724508-7724530 TGTTTTAACTAGAGTGGTCAGGG + Intergenic
1170737559 20:19024979-19025001 GGTTCTAATTGGAGTCACCTGGG + Intergenic
1170804092 20:19614790-19614812 TGTTCTTAGCAGAGTGATCCAGG - Intronic
1175353346 20:58342591-58342613 TGTCCTGATTGGAGTGATTTGGG + Intronic
1175425841 20:58865781-58865803 TATTCTAGTTAGGGTCATCTGGG - Intronic
1177039292 21:16086949-16086971 TGTTCTGATTAAGGTGATATTGG - Intergenic
1178348642 21:31853775-31853797 TGTTTTAATTAGAGTTCTCCAGG - Intergenic
1182995032 22:34804058-34804080 TGTTCCAAGTAGAGTAATTTGGG - Intergenic
949823932 3:8144511-8144533 TATTCTAAACAGAGTGATCTAGG + Intergenic
956293776 3:67690321-67690343 CTTTCCATTTAGAGTGATCTTGG - Intergenic
956590863 3:70913364-70913386 TTTTCTTATTTGTGTGATCTTGG + Intergenic
957162102 3:76623366-76623388 GGTTCTAATTAGAGTAACCTTGG + Intronic
957530736 3:81438047-81438069 TGTTTTAATCAGATTGATTTGGG - Intergenic
959782324 3:110249392-110249414 TGGTCTAATTAGAGTGCTTGTGG - Intergenic
960257008 3:115521173-115521195 TGTTCTCATTTGGGTGGTCTGGG + Intergenic
961234605 3:125355168-125355190 TGTTGTCATTAGAATGATCATGG - Intronic
963161101 3:142150781-142150803 AGTCCTAAATAGAGTGATCTGGG + Intergenic
964080079 3:152743784-152743806 TATTCTACTTGGAGTGATCTGGG - Intergenic
965965799 3:174487295-174487317 TGTATTAATTAGAGACATCTAGG - Intronic
967377478 3:188821321-188821343 TATTCTGATTTGAGTGATCTAGG - Intronic
968365168 3:198179450-198179472 TGTTAGAATTAGAGACATCTGGG - Intergenic
970266731 4:14296564-14296586 TGTTCTAATTTGCATGATTTGGG - Intergenic
970304948 4:14721531-14721553 AGTTCTAATTTGAGTGCACTGGG - Intergenic
970429682 4:15977223-15977245 TGTTCTAAGAAGAGTCATCCAGG - Intronic
970682292 4:18524005-18524027 TACTATAATTAAAGTGATCTGGG - Intergenic
974526113 4:63051975-63051997 TGCTCTAATTAATCTGATCTAGG + Intergenic
974587057 4:63893043-63893065 TGTACTAATGAGAGTGTTCCTGG - Intergenic
974732145 4:65881180-65881202 TGCTCTCATAAGAGTCATCTGGG + Intergenic
976237328 4:82912233-82912255 TGATATATTTAGTGTGATCTTGG + Intronic
976767157 4:88609622-88609644 TGTTCTAATCAGATAGTTCTTGG + Intronic
976807601 4:89065584-89065606 TGTTGTAATTGGAGTGACATAGG - Intronic
978646531 4:110939369-110939391 TTTTATAATTAGATTGATGTGGG - Intergenic
981664425 4:147207107-147207129 AGTTCTAAAAAGAGTGAACTTGG + Intergenic
983277005 4:165629946-165629968 TGATCTAATTTTAGAGATCTGGG - Intergenic
986039822 5:3982453-3982475 TTTGCTAAATAGAGTTATCTTGG - Intergenic
987532200 5:19135559-19135581 TGTCATAACTAGAATGATCTTGG - Intergenic
989025711 5:37065204-37065226 TGTTCTTAATAAAGTGTTCTTGG + Exonic
991261265 5:64670905-64670927 TTTTCTCATTACAGTGTTCTAGG + Intergenic
998198931 5:140102479-140102501 TATTTTAAATAGAGTGATCAAGG - Intergenic
999266831 5:150271988-150272010 TCTGCAAATTAGAGTTATCTGGG + Intronic
1007045234 6:38766742-38766764 TGTGCTAATTAGCTTGATTTTGG + Intronic
1008410874 6:51177937-51177959 TTTTCTGATTAGCATGATCTAGG + Intergenic
1009277252 6:61698908-61698930 TGGTCTAAATAGACTGATCAGGG - Intronic
1011091815 6:83611269-83611291 TGTTATAATTAGTGGGAGCTAGG + Intronic
1011472072 6:87717920-87717942 TGTTCTCATCAGAGTGCTTTTGG + Intergenic
1012985669 6:105873930-105873952 AGTTCTAGGTAGAGTGCTCTGGG - Intergenic
1015480835 6:133706901-133706923 TGTTTGAATAAGTGTGATCTTGG + Intergenic
1015559802 6:134502511-134502533 TGTTTTAATCAGAGTGATAGTGG + Intergenic
1016020921 6:139235617-139235639 TGTTCTTATGATAGTGATATGGG + Intergenic
1016351000 6:143167317-143167339 CACTCTAATTAGAGTTATCTAGG - Intronic
1017296221 6:152797776-152797798 TGTTTTCATTAGAGTCATTTTGG + Intergenic
1018534329 6:164804251-164804273 TTTTTAAATTAGAGTCATCTTGG + Intergenic
1018549070 6:164973223-164973245 TGTTCAAATTAGAGTGATAAAGG - Intergenic
1018652741 6:166005598-166005620 TTTTCTATTTAAAGTCATCTGGG - Intergenic
1019251023 7:11442-11464 TGTTAGAATTAGAGACATCTGGG + Intergenic
1023128633 7:36979794-36979816 AGTTCTAACTAGAGTCATCTAGG - Intronic
1024069286 7:45772205-45772227 TGTTAGAATTAGAGACATCTGGG - Intergenic
1025100102 7:56127462-56127484 TGTTAGAATTAGAGACATCTGGG + Intergenic
1028425741 7:90686431-90686453 TGTTCTAATGAGAATGAATTTGG + Intronic
1029509239 7:100983067-100983089 TGTTATAATCTGAGTGACCTTGG + Intronic
1029944129 7:104513766-104513788 AATTCTGATTAAAGTGATCTTGG + Intronic
1031076428 7:117217521-117217543 GGTTCTAATGAGAGAGATGTTGG + Intronic
1031128686 7:117805782-117805804 TGTTTAAATTTGAGTCATCTTGG + Intronic
1033416283 7:141164294-141164316 TGTTATCATTAGAGTGAGATAGG + Intronic
1034025876 7:147703205-147703227 TGTTCTAATTAGAGTGATCTGGG - Intronic
1034877316 7:154736873-154736895 AATTCTAATAAGAGTGATCATGG - Intronic
1039290350 8:36088078-36088100 TCTACTAATCATAGTGATCTAGG - Intergenic
1041409292 8:57535873-57535895 TGTTCTAGTTGGAGTGCTTTTGG + Intergenic
1043058273 8:75467791-75467813 AGATCTGATTAGAGTCATCTGGG - Intronic
1044792278 8:95859912-95859934 TCTTCTGATTAGACTGTTCTGGG + Intergenic
1046058215 8:109104034-109104056 AGTTCTCATTAGAAAGATCTTGG + Intronic
1052555157 9:30003594-30003616 TGTTTTAATTAGCTTGATTTAGG - Intergenic
1052681647 9:31700714-31700736 TGCTCTTATTAGAGTGAAATAGG - Intergenic
1053219570 9:36300691-36300713 ACTTCTAATTAGAGGGATCAAGG - Intronic
1056117154 9:83451740-83451762 AGTTCTGATTTGAGTGCTCTTGG - Intronic
1056964704 9:91155976-91155998 TGTTCCAGGTAGAGTCATCTAGG - Intergenic
1058035066 9:100242860-100242882 TGTTATCATTAGAGTGAATTAGG - Intronic
1058317841 9:103590757-103590779 TGTTCTCTTTAAAGTCATCTAGG - Intergenic
1058329050 9:103736105-103736127 TGTACTAAGTAGAATGATCATGG + Intergenic
1059503228 9:114774534-114774556 AGCTCTATGTAGAGTGATCTTGG + Intergenic
1060383527 9:123200402-123200424 TTTTCTAATTAGGGTGATACTGG + Intronic
1062749538 9:138242328-138242350 TGTTAGAATTAGAGACATCTGGG - Intergenic
1187799981 X:23050824-23050846 TATTCTAATTTAATTGATCTGGG - Intergenic
1188484120 X:30663798-30663820 TGCTGTAATTAGAGTAATTTTGG + Intronic
1188512593 X:30952626-30952648 TGTTAAAATTAGGGTAATCTGGG + Intronic
1191190276 X:57659046-57659068 TGTCCAATTTAGAGTGACCTGGG + Intergenic
1191976392 X:66876629-66876651 TGTTCTACTGAGTGTGATTTAGG + Intergenic
1192661105 X:73043906-73043928 TGTCCAACTTAGAGTGACCTGGG - Intergenic
1193895223 X:87106097-87106119 TGTTCTAATGAGAGGGAATTAGG + Intergenic
1194397671 X:93405146-93405168 TGTTCTCATGAGAGTGAACAAGG - Intergenic
1194590158 X:95790508-95790530 TGTTCTTATGAGAGTGTTTTGGG + Intergenic
1195027128 X:100888682-100888704 TATTTTAAATAGAGTGATCAGGG + Intergenic
1196276744 X:113774966-113774988 TGTTCTATTTAGATTGATGTAGG + Intergenic
1198699353 X:139381152-139381174 TGTGCGAAACAGAGTGATCTTGG - Intergenic
1201984083 Y:19944054-19944076 TTTTCCATTTAGAGTGATGTTGG + Intergenic