ID: 1034029434

View in Genome Browser
Species Human (GRCh38)
Location 7:147743853-147743875
Sequence TGCCATGGTGATGGCTACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034029425_1034029434 16 Left 1034029425 7:147743814-147743836 CCAGCTCCGTGGCTTCTCCCCAC 0: 1
1: 0
2: 22
3: 110
4: 490
Right 1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG No data
1034029419_1034029434 29 Left 1034029419 7:147743801-147743823 CCTATCTCCTCCCCCAGCTCCGT 0: 1
1: 0
2: 7
3: 49
4: 665
Right 1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG No data
1034029421_1034029434 22 Left 1034029421 7:147743808-147743830 CCTCCCCCAGCTCCGTGGCTTCT 0: 1
1: 1
2: 2
3: 48
4: 565
Right 1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG No data
1034029424_1034029434 17 Left 1034029424 7:147743813-147743835 CCCAGCTCCGTGGCTTCTCCCCA 0: 1
1: 0
2: 0
3: 45
4: 363
Right 1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG No data
1034029423_1034029434 18 Left 1034029423 7:147743812-147743834 CCCCAGCTCCGTGGCTTCTCCCC 0: 1
1: 0
2: 3
3: 50
4: 372
Right 1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG No data
1034029426_1034029434 10 Left 1034029426 7:147743820-147743842 CCGTGGCTTCTCCCCACTGTCTC 0: 1
1: 0
2: 4
3: 61
4: 619
Right 1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG No data
1034029422_1034029434 19 Left 1034029422 7:147743811-147743833 CCCCCAGCTCCGTGGCTTCTCCC 0: 1
1: 0
2: 2
3: 42
4: 388
Right 1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG No data
1034029418_1034029434 30 Left 1034029418 7:147743800-147743822 CCCTATCTCCTCCCCCAGCTCCG 0: 1
1: 0
2: 6
3: 59
4: 594
Right 1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG No data
1034029427_1034029434 -1 Left 1034029427 7:147743831-147743853 CCCCACTGTCTCCTCCTGTCTTT 0: 1
1: 0
2: 6
3: 103
4: 847
Right 1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG No data
1034029429_1034029434 -3 Left 1034029429 7:147743833-147743855 CCACTGTCTCCTCCTGTCTTTGC 0: 1
1: 0
2: 2
3: 66
4: 794
Right 1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG No data
1034029428_1034029434 -2 Left 1034029428 7:147743832-147743854 CCCACTGTCTCCTCCTGTCTTTG 0: 1
1: 0
2: 1
3: 41
4: 458
Right 1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034029434 Original CRISPR TGCCATGGTGATGGCTACTG TGG Intronic
No off target data available for this crispr