ID: 1034035960

View in Genome Browser
Species Human (GRCh38)
Location 7:147822460-147822482
Sequence TGCAATACTTCCAACAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034035960_1034035965 22 Left 1034035960 7:147822460-147822482 CCCACCCTGTTGGAAGTATTGCA 0: 1
1: 0
2: 1
3: 9
4: 143
Right 1034035965 7:147822505-147822527 CTGACTTCTAGATATATTTTTGG 0: 1
1: 0
2: 0
3: 22
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034035960 Original CRISPR TGCAATACTTCCAACAGGGT GGG (reversed) Intronic
907959058 1:59261278-59261300 GGCAATGCTTCCAGAAGGGTGGG - Intergenic
911743540 1:101414139-101414161 TGGAATAATTTCAACAGGATTGG - Intergenic
912027645 1:105198764-105198786 TGAAATACTTGCCACAGTGTGGG - Intergenic
913608539 1:120489097-120489119 TGCAAGAATTTCAACAGAGTTGG + Intergenic
914051093 1:144132491-144132513 TTCTATACTTCCTACAGAGTTGG - Intergenic
914128088 1:144832952-144832974 TTCTATACTTCCTACAGAGTTGG + Intergenic
914582663 1:149032741-149032763 TGCAAGAATTTCAACAGAGTTGG - Exonic
915205949 1:154270462-154270484 TATAATACATACAACAGGGTGGG - Exonic
915243040 1:154537478-154537500 TGCAAAATTTCCACCAGGATGGG + Intronic
916824335 1:168429796-168429818 TGCTATATTTCTACCAGGGTTGG - Intergenic
918067841 1:181113440-181113462 TGCCAGATTTCCAACAGGGCAGG - Intergenic
918638980 1:186815433-186815455 GGGAATACTTCCACCAGAGTAGG - Intergenic
1066682539 10:37947998-37948020 TGCCACACTTCCTAAAGGGTAGG + Intergenic
1066760839 10:38750810-38750832 TTCTATACTTCCTACAGAGTTGG + Intergenic
1066960741 10:42221612-42221634 TTCTATACTTCCTACAGAGTTGG - Intergenic
1068961393 10:62869995-62870017 TGAAATACTGCCAACAAGATAGG - Intronic
1070643439 10:78185296-78185318 TGCAATACAACCAGCACGGTTGG - Intergenic
1077069587 11:662458-662480 TTCAGTACTTCCTACAGGGCAGG + Intronic
1082129883 11:48475341-48475363 TGCAAATTTTCTAACAGGGTAGG - Intergenic
1085134110 11:74069366-74069388 TGCTATACCCCCCACAGGGTTGG + Intronic
1089582786 11:119491955-119491977 TGCGATACTTCCAACTGTCTGGG + Intergenic
1093356918 12:18177687-18177709 TGTTATACTTCCATCAGGGGTGG - Intronic
1098093237 12:66926433-66926455 TGCAGTACTTCCAGCAGGCGAGG - Intergenic
1099725118 12:86416187-86416209 AAAAATACTTCCAACAGGTTTGG - Intronic
1101377477 12:104183700-104183722 TGCAGGACTTGCAACAGGGGTGG + Intergenic
1103315050 12:120046693-120046715 TGCACTAATTCCAACATGGATGG - Intronic
1104226111 12:126835471-126835493 TGCAATACTTTCAGTAGGATTGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106167362 13:27260253-27260275 TAAAATACTTCCATCAGGGAAGG - Intergenic
1107894404 13:44946505-44946527 AGAAATACTTCCAAATGGGTTGG - Intronic
1108041568 13:46344145-46344167 TGCAACACTGCCTAAAGGGTTGG + Intronic
1108111293 13:47076226-47076248 TGGAATACTTTCAATAGGATTGG - Intergenic
1110332469 13:74288539-74288561 TGCACTCCTCTCAACAGGGTGGG + Intergenic
1110430646 13:75418983-75419005 TGCCATAACTCCAAAAGGGTTGG + Intronic
1112099355 13:96169973-96169995 GGCAATAATTCTAACTGGGTTGG - Intronic
1116627335 14:47282381-47282403 TACAAAAATTCAAACAGGGTAGG + Intronic
1118701730 14:68439889-68439911 TGCCATGCTTTCAACAGGGGAGG - Intronic
1121210993 14:92207784-92207806 TGCAATACCTCCAACAGCCTGGG - Intergenic
1123420953 15:20131807-20131829 TTCTATACTTCCTACAGAGTTGG - Intergenic
1123444896 15:20321706-20321728 TTCTATACTTCCTACAGAGTTGG + Intergenic
1123530177 15:21138336-21138358 TTCTATACTTCCTACAGAGTTGG - Intergenic
1125690499 15:41592351-41592373 TGTTATACTTCCATCAGGGGCGG - Intergenic
1132339023 15:101066317-101066339 TGCTGTTCTTCCAAGAGGGTTGG + Intronic
1133961115 16:10494302-10494324 TGTTATACTTCCATCAGGGGCGG - Intergenic
1134263183 16:12670415-12670437 TGCACTACTTCCTAGAGGGTGGG - Intronic
1136721923 16:32327214-32327236 TTCTATACTTCCTACAGAGTTGG - Intergenic
1136840247 16:33533180-33533202 TTCTATACTTCCTACAGAGTTGG - Intergenic
1137820228 16:51437210-51437232 TGCACTAATTCCTACAGGCTTGG - Intergenic
1141225123 16:82107767-82107789 TGCATTTCTTTCTACAGGGTTGG + Intergenic
1203004508 16_KI270728v1_random:190557-190579 TTCTATACTTCCTACAGAGTTGG + Intergenic
1203136118 16_KI270728v1_random:1726988-1727010 TTCTATACTTCCTACAGAGTTGG + Intergenic
1203150413 16_KI270728v1_random:1833470-1833492 TTCTATACTTCCTACAGAGTTGG - Intergenic
1143554631 17:7652394-7652416 TGGAATTCTTCCAAGAGGGATGG + Intronic
1144767478 17:17740439-17740461 TGAACCACTTCCACCAGGGTGGG - Intronic
1156600912 18:38604891-38604913 TGCAATGCCTCAAACAGGGTAGG + Intergenic
1160224262 18:76999889-76999911 TGCAGTACTTGAAACAGGTTGGG - Intronic
1164665450 19:30030454-30030476 GACAATAGTTCTAACAGGGTGGG - Intergenic
1166226925 19:41401769-41401791 TTCCTGACTTCCAACAGGGTAGG - Intronic
1202690500 1_KI270712v1_random:85129-85151 TTCTATACTTCCTACAGAGTTGG - Intergenic
926381260 2:12292414-12292436 TGCAATCCCACCAACAGTGTTGG + Intergenic
929957238 2:46467424-46467446 CACAATAATTCCAACAGGGAAGG - Intronic
933111044 2:78400701-78400723 TGCAATAGTGTCAATAGGGTAGG - Intergenic
933676883 2:85064995-85065017 TGCAGCAGTTCCAAAAGGGTGGG - Intergenic
933955915 2:87370876-87370898 TTCTATACTTCCTACAGAGTTGG + Intergenic
934240068 2:90262907-90262929 TTCTATACTTCCTACAGAGTTGG + Intergenic
934273123 2:91553844-91553866 TTCTATACTTCCTACAGAGTTGG - Intergenic
934462517 2:94226189-94226211 TTCTATACTTCCTACAGAGTTGG + Intergenic
934954767 2:98608447-98608469 CGCAACACTTGCAACCGGGTCGG + Exonic
935208240 2:100915218-100915240 AGCTACACTTCCAAGAGGGTGGG + Intronic
936493899 2:113000417-113000439 TGCTTTACTTCCAAGAGGGAGGG + Intergenic
936716151 2:115189963-115189985 TGTTATACTTCCATCAGGGGTGG + Intronic
937502502 2:122495342-122495364 TGTGGTACTTGCAACAGGGTGGG - Intergenic
939443657 2:142280993-142281015 TGAAATACTTCCACATGGGTTGG + Intergenic
939538371 2:143461837-143461859 AGCAATAGTTCCAATAGGATTGG + Intronic
940995078 2:160140501-160140523 TCCAATACTCTCAACAGTGTTGG - Intronic
943158360 2:184214211-184214233 TGGAATAATTCCAATAGGATTGG + Intergenic
943503446 2:188722028-188722050 TGCATTACTGTCAACAGGATAGG - Intergenic
943638001 2:190327225-190327247 TGAAATACTTCCAAAATGATTGG + Intronic
946802036 2:223428181-223428203 TGGAATACTGCCAATAGGATTGG + Intergenic
947653545 2:231807771-231807793 TGGAACAGTACCAACAGGGTGGG - Exonic
1170441069 20:16379228-16379250 TGCTTTTCTTCCAACAGAGTTGG + Exonic
1177778574 21:25597880-25597902 TGCTATACTTTGCACAGGGTGGG - Intronic
1178722432 21:35021933-35021955 CTCAATGCTTCCAAAAGGGTAGG + Intronic
1179113358 21:38466770-38466792 TGGACAACTTACAACAGGGTGGG + Intronic
1181353078 22:22274498-22274520 TTCTATACTTCCTACAGAGTTGG - Intergenic
950594123 3:13963898-13963920 TGTTATACTTCCATCAGGGGCGG + Intronic
951220583 3:20065147-20065169 TGCACTACTTTCAACAGGACTGG - Intronic
957914206 3:86665723-86665745 TGCAATACTTACAGGAGGGAAGG + Intergenic
959519846 3:107313040-107313062 TGCAATAGTTTCAACAGGAATGG + Intergenic
961334701 3:126165476-126165498 TGTAATACTTTCAATAGGATTGG + Intronic
961841215 3:129714336-129714358 TACACTACTGCCAACAGTGTAGG + Intronic
964644598 3:158945294-158945316 TGAAATACTGCCATCAGGGCAGG - Intergenic
965737038 3:171831702-171831724 TTTAATACCTACAACAGGGTCGG - Intergenic
972587752 4:40453769-40453791 TGCAATCCTCCCTACAGGGAAGG + Intronic
976004727 4:80416151-80416173 TGCCAGATTTCCAACAGGATGGG - Intronic
982119320 4:152125877-152125899 TGGAATACTGTCAAAAGGGTGGG + Intergenic
982467504 4:155748684-155748706 TGCAGTACTTCCCTAAGGGTTGG + Intergenic
983687210 4:170424613-170424635 TACATTACTACCAACAGTGTAGG + Intergenic
984369427 4:178843195-178843217 TGAAATAATTCAAAAAGGGTTGG + Intergenic
984426487 4:179593816-179593838 TTCAATTCTTCCAGCATGGTAGG - Intergenic
984540124 4:181027582-181027604 TGCAATGCTTCCAACAGGCTAGG - Intergenic
989081758 5:37630342-37630364 TGCAATGTTTCCACCAGGGGTGG + Intronic
992146219 5:73852027-73852049 TGAAATACTTACTACAGGGGTGG - Intronic
998462346 5:142319229-142319251 TGCAATGCAACCAACAGGGAAGG + Intronic
998552314 5:143089480-143089502 TGTTATACTTCCATCAGGGGTGG + Intronic
999526410 5:152410967-152410989 TACAATACTGCCTACAAGGTAGG + Intronic
1002487289 5:179548193-179548215 TGCAAAACTCCCAACAGGCTGGG + Intergenic
1009034830 6:58104330-58104352 TGCATTAATTCCAAGAGGATTGG + Intergenic
1011570540 6:88729769-88729791 TGTTATACTTCCATCAGGGGCGG - Intronic
1012810649 6:103953029-103953051 TGGAATACTTTCAATAGGATTGG - Intergenic
1012978144 6:105801991-105802013 TGCTGTACTTCCTACAGGGGAGG + Intergenic
1017085073 6:150706200-150706222 TTCAGTACTTCCATAAGGGTGGG + Intronic
1019626391 7:2018028-2018050 TGCAGCACCTCCAACAGGGCCGG - Intronic
1020655917 7:10927866-10927888 TGTTATACTTCCATCAGGGGTGG - Intergenic
1020997705 7:15284660-15284682 TGGACTAGTTCCAGCAGGGTTGG - Intronic
1021543311 7:21784773-21784795 TTGAATATTTCCAACAGTGTGGG + Intronic
1021600739 7:22360820-22360842 TGCAATTTTTCCTACAGGATGGG + Intergenic
1023799243 7:43819151-43819173 TGTTATACTTCCATCAGGGGTGG - Intergenic
1023889825 7:44384151-44384173 TGGAAGACTACCCACAGGGTGGG + Exonic
1028793874 7:94882521-94882543 TGTTATACTTCCATCAGGGGCGG - Intergenic
1030575137 7:111276499-111276521 TGGAATAGTTCCAAGAGGATTGG + Intronic
1030990668 7:116295863-116295885 TGGAATAGTTTCAATAGGGTTGG - Intronic
1033242627 7:139692934-139692956 TCCATTACCTCCAACAGGTTTGG + Intronic
1034035960 7:147822460-147822482 TGCAATACTTCCAACAGGGTGGG - Intronic
1041691160 8:60688738-60688760 TGCAATTCTCCAAACATGGTGGG + Intronic
1042688324 8:71466107-71466129 TGCAATACTTCTAAAATGATGGG + Intronic
1043104872 8:76095403-76095425 TTAAATATTTCCTACAGGGTAGG + Intergenic
1045200781 8:99978764-99978786 TACATTACTTCCAAGAAGGTAGG + Intronic
1047113863 8:121818921-121818943 TGCAGGACTTGCAACAGGGGTGG - Intergenic
1050166945 9:2774882-2774904 TCCAATACTTCCAATAGGAGTGG - Intronic
1051993759 9:23187569-23187591 GGCAATACTTCCACCAGACTCGG + Intergenic
1053693035 9:40606826-40606848 TTCTATACTTCCTACAGAGTTGG + Intergenic
1054271800 9:63033263-63033285 TTCTATACTTCCTACAGAGTTGG - Intergenic
1054304276 9:63406058-63406080 TTCTATACTTCCTACAGAGTTGG + Intergenic
1054403020 9:64730071-64730093 TTCTATACTTCCTACAGAGTTGG + Intergenic
1054436643 9:65215561-65215583 TTCTATACTTCCTACAGAGTTGG + Intergenic
1054493754 9:65806433-65806455 TTCTATACTTCCTACAGAGTTGG - Intergenic
1056860989 9:90181660-90181682 TGCAAAACCACCAACAGGGAGGG + Intergenic
1057748994 9:97774973-97774995 TGAAACACTTAGAACAGGGTTGG + Intergenic
1057943372 9:99304145-99304167 TGTATTACTTCCAATAGGGTGGG + Intergenic
1059657177 9:116367628-116367650 TGCTGTACTTCCCTCAGGGTCGG + Exonic
1060577288 9:124708286-124708308 TGCAGTAGTTCAACCAGGGTGGG - Intronic
1186348513 X:8719258-8719280 GTCATTACTTCCAACAGTGTAGG + Intronic
1187039854 X:15582241-15582263 TACATTCCTTCCAACAGTGTAGG - Intronic
1188900778 X:35730657-35730679 TGGAATACTTTCAACAGGAATGG + Intergenic
1189565574 X:42237749-42237771 TGCCATCCTTCCAGCAGAGTTGG + Intergenic
1190397021 X:49995332-49995354 GGCAATACTTCAAACAGAATGGG + Intronic
1192081630 X:68053483-68053505 TGGAATACTCCCAACAGGGCTGG + Intronic
1193203326 X:78718394-78718416 TGGAATAGTTCTAACAGGTTGGG - Intergenic
1193285935 X:79714548-79714570 TGCTACACTTCCAAATGGGTTGG - Intergenic
1193440232 X:81531610-81531632 TGGAATAGTTTCAACAGGGTTGG + Intergenic
1193752177 X:85359329-85359351 TGCAATACTTCCAAGCAGGTTGG - Intronic
1200759543 Y:7025420-7025442 TGCAATACTGCAAACTGGGATGG + Intronic
1201328517 Y:12793112-12793134 TGCTTTACTTCCAACAGCGTTGG + Exonic