ID: 1034038801

View in Genome Browser
Species Human (GRCh38)
Location 7:147854623-147854645
Sequence GTGGCTAGGAACCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034038801_1034038805 20 Left 1034038801 7:147854623-147854645 CCAGCACAGTGGTTCCTAGCCAC 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1034038805 7:147854666-147854688 TAATATGGCTACTGTGACAGAGG No data
1034038801_1034038804 5 Left 1034038801 7:147854623-147854645 CCAGCACAGTGGTTCCTAGCCAC 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1034038804 7:147854651-147854673 ACTGTTGAGCACTCGTAATATGG 0: 1
1: 0
2: 2
3: 40
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034038801 Original CRISPR GTGGCTAGGAACCACTGTGC TGG (reversed) Intronic
904083495 1:27887114-27887136 GTGACTAGGAAACATTGTGGAGG - Intergenic
907409280 1:54273461-54273483 GTTGCTAGGAGCCCCAGTGCCGG + Intronic
908536479 1:65083197-65083219 GTCACTAGGATCCACTGAGCTGG + Intergenic
912502148 1:110129830-110129852 CTGGCTAGGACACAGTGTGCTGG - Intergenic
912868980 1:113285958-113285980 GTGGCTAAGAATCAGTGTTCAGG - Intergenic
913341340 1:117760497-117760519 GTGGCTAGGTATCAAAGTGCTGG + Intergenic
917549620 1:176011187-176011209 GTGGCTAGTGACTACTGTACTGG - Intronic
920676457 1:208041682-208041704 GTGGCTAGGGGCCGCTGTGCCGG + Intronic
921796840 1:219355140-219355162 GTGGCTAAGGACTACTGTGTTGG - Intergenic
922499078 1:226083605-226083627 GTGGCTGGAACCCCCTGTGCAGG - Intergenic
1064205587 10:13321122-13321144 GGGGCAAGGGACCACAGTGCTGG - Intronic
1064326573 10:14356866-14356888 GTGGGGAGCAACCACGGTGCTGG + Intronic
1067668020 10:48295200-48295222 CAGGCCAGGAACCACTGTCCTGG - Intergenic
1069238157 10:66104233-66104255 GGGGCTAGGAAACACTTGGCAGG - Intronic
1070311513 10:75276724-75276746 GGGGCTGGGAGCAACTGTGCTGG + Intergenic
1070935220 10:80288865-80288887 CTGTCTTGGACCCACTGTGCTGG + Intronic
1071876917 10:89852374-89852396 GTGCCTAGGACCCACTGGGCTGG - Intergenic
1073920779 10:108456034-108456056 GTGGCTAGAAGCTATTGTGCTGG + Intergenic
1074939447 10:118220142-118220164 GTGGCCAGGCAGGACTGTGCTGG - Intergenic
1076510525 10:131011167-131011189 GTGGCCAAGACCCACTGTGTGGG - Intergenic
1077959083 11:7053948-7053970 GAGGCTAGGAAGCACAGTGGGGG - Intronic
1078407201 11:11080763-11080785 GTGACTCAGAACCACTGGGCTGG + Intergenic
1080188637 11:29520740-29520762 CTGGCTAGAAGCCACTATGCCGG + Intergenic
1081590757 11:44421427-44421449 GTGGTTTGGAGCCACTGTGGAGG + Intergenic
1082222996 11:49664538-49664560 GTGGCTAGTAGCCACTGTAGTGG - Intergenic
1083547979 11:63563143-63563165 GTGGGAAGGAACCACGGTGCTGG - Intronic
1089125012 11:116170768-116170790 CAGGCTAGGGAACACTGTGCTGG + Intergenic
1090042442 11:123302543-123302565 ATGGCTAGGGACCACTGTGCTGG - Intergenic
1092649379 12:10616391-10616413 GTGGCTAGAAGCTACTGTGTTGG + Intergenic
1099561679 12:84184891-84184913 GTGGCTAGTGACTACTGTACTGG + Intergenic
1100437826 12:94588171-94588193 GCGGCTTGGACACACTGTGCAGG + Intronic
1102397519 12:112599852-112599874 GTGCCTATTAACCACTATGCAGG - Intronic
1106287386 13:28329511-28329533 GAGGCGAGGAAGCACAGTGCGGG + Intronic
1108670152 13:52678530-52678552 GTGGCTAGCAGCTACTGTGTTGG - Intronic
1110110559 13:71739623-71739645 GTGGGTAGCAGCCACTGTCCTGG + Intronic
1111046478 13:82820467-82820489 GTTGCAGGGAACCACTGTGCTGG - Intergenic
1117555188 14:56876702-56876724 GGTGCTGGAAACCACTGTGCTGG + Intergenic
1119544306 14:75460550-75460572 GTGCCTGGGAACCACTGGCCTGG + Intronic
1122230340 14:100303795-100303817 GTGGGGAGGAACCACTGTCCTGG + Intronic
1122674181 14:103396849-103396871 GTGGCTAGTTGCTACTGTGCTGG - Intronic
1122713834 14:103681251-103681273 GAGTCTAGGAACCACTGCACTGG - Intronic
1127930423 15:63592960-63592982 GTGGCTAGGGGCCATTGTACTGG - Intronic
1128882866 15:71259580-71259602 AGGGCTGAGAACCACTGTGCTGG - Intronic
1130653429 15:85775384-85775406 GTGGCCGTGAATCACTGTGCAGG - Intronic
1132113497 15:99119201-99119223 GAGGTTTGAAACCACTGTGCCGG - Intronic
1134156885 16:11851365-11851387 GTGGCTTGGAAGCAGTGTGGCGG - Intronic
1138828734 16:60353297-60353319 TTGGGTAGGATCCACTGGGCAGG + Intergenic
1141597307 16:85105139-85105161 GTGGCCAGGATTAACTGTGCCGG + Intronic
1141842665 16:86584102-86584124 GTGGAAAGGAGCCACAGTGCTGG + Intergenic
1142209306 16:88800547-88800569 TTGGCCAGGAACCCTTGTGCAGG - Intergenic
1142282387 16:89155303-89155325 GTGGCCAGAAACGAGTGTGCCGG + Exonic
1142368822 16:89666381-89666403 GCAGCCATGAACCACTGTGCCGG - Intronic
1143516399 17:7421310-7421332 GTGGCTAGGAGCCTCAGGGCTGG - Exonic
1144025014 17:11269896-11269918 GTGGCTAGGAACCAATATATTGG - Intronic
1146254467 17:31382649-31382671 GTGGCTAGTGGCCACTGTCCTGG - Intergenic
1146401852 17:32505628-32505650 GTGGCAAGGAACCTCTGGGTGGG + Intronic
1147919159 17:43905976-43905998 ATGCCCAGGATCCACTGTGCTGG + Intronic
1148777945 17:50106062-50106084 GTGGCCGGCACCCACTGTGCTGG - Exonic
1149482853 17:57017616-57017638 CTGGCTGGAAACCTCTGTGCTGG + Intergenic
1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG + Intronic
1152427253 17:80225069-80225091 GTAGCTGGGATCCACAGTGCAGG - Intronic
1154055500 18:11009424-11009446 AGGGCTGAGAACCACTGTGCTGG + Intronic
1156479087 18:37424973-37424995 GTGGCCAGAGAGCACTGTGCGGG - Intronic
1157647290 18:49287861-49287883 GTGGCTAGTGGCCACTGTACTGG - Intronic
1158281408 18:55832410-55832432 GTGGCTAGCAGCTACTGTACTGG + Intergenic
1159023424 18:63161694-63161716 GTTGATGGGAACCCCTGTGCTGG - Intronic
1164120771 19:22262826-22262848 GTGACTAGGAAACACTATTCAGG + Intergenic
1164402384 19:27911010-27911032 CTGCCTAGGAGCCACTGGGCAGG + Intergenic
1164890819 19:31821643-31821665 ATAGCTATGAACCATTGTGCTGG - Intergenic
925153286 2:1632053-1632075 GTGTCTAGCAGCCACTGTGCGGG - Exonic
931496495 2:62813172-62813194 GTGGCTAAAAATCACTGAGCTGG - Intronic
932659667 2:73641393-73641415 TTGGCAAGGAACCACAGGGCAGG + Exonic
932666230 2:73701070-73701092 TTGGCAAGGAACCACAGGGCAGG + Intergenic
934117084 2:88808473-88808495 GTGGGTTGGAACCAGTGAGCTGG + Intergenic
936523704 2:113228624-113228646 CTGGCTAAGAACCATTGTGTTGG + Intronic
937211276 2:120273311-120273333 GTGGCGAGGAACCACAGGACTGG + Intronic
938950110 2:136247420-136247442 GTGGCTTGTGGCCACTGTGCTGG + Intergenic
941672740 2:168311929-168311951 GTGGCTAGTAACTACTGTATTGG + Intergenic
942230432 2:173856417-173856439 ATGGCAAGGAACGACTCTGCTGG + Intergenic
943803264 2:192089185-192089207 GAGGTTAGGAAAGACTGTGCTGG - Intronic
944883631 2:204041003-204041025 CTGGTTAAGAACCACTGTACTGG + Intergenic
946061666 2:216947239-216947261 GTGGCTAGCAGCCACTGTACTGG + Intergenic
948288742 2:236808477-236808499 CTGGCTAGGAGGCACTGTGCAGG - Intergenic
948372611 2:237499276-237499298 GTGGCTAGTAACTTCTGTCCTGG - Intronic
1172288610 20:33758846-33758868 GTGGCTGGGACCATCTGTGCTGG + Intronic
1173147230 20:40535254-40535276 GTTGTTAGGAACCACTGTTCAGG - Intergenic
1175468073 20:59206392-59206414 GTGGCTAGTGACCACTGTACTGG - Intronic
1178737525 21:35166523-35166545 TTGGCTCGGAACCACTCTTCAGG + Intronic
1181908978 22:26222820-26222842 CTGGTTAAGAACCACTGTGATGG - Intronic
1182027197 22:27129569-27129591 CTGGCTCCTAACCACTGTGCAGG + Intergenic
949173858 3:1034857-1034879 GTGGCTTTGCAGCACTGTGCTGG + Intergenic
951668393 3:25152423-25152445 GTGGCAAGGAAAAACTGTGAGGG + Intergenic
952232383 3:31445444-31445466 CAGGTTAGGAACCACTGTTCTGG + Intergenic
953143971 3:40256040-40256062 GTGGCTAGTGGCCACTGTACTGG - Intronic
953783754 3:45895018-45895040 GTGGGAAGGATCCACTGTGGGGG + Intronic
954524964 3:51261819-51261841 GTGGCTTGGCAGCACTGTGGTGG - Intronic
956083353 3:65583177-65583199 GTGGCTAGTGACCACTGACCTGG + Intronic
956260662 3:67336746-67336768 CTGGCTAGGATCCATTGTGAAGG - Intergenic
962149607 3:132879044-132879066 TTGTCTAGGTACCACTGTCCTGG - Intergenic
963060250 3:141219847-141219869 AGGGCTGGGAACCACTGTGGAGG - Intergenic
964195683 3:154061901-154061923 GTGTCTAGGAAAGACTGTGTTGG - Intergenic
967110668 3:186290715-186290737 GTGGCTAGGATTCACAGAGCAGG + Intronic
968736145 4:2297469-2297491 GAGGCCAGGACCCACTGTCCGGG + Intronic
971595094 4:28516727-28516749 GTGGCTTTGAAGAACTGTGCTGG - Intergenic
972821204 4:42703943-42703965 TTGGCTAGGAGCCAGTGTGCAGG - Intergenic
975068396 4:70099356-70099378 GTGACCAGTAACCACTGTGGAGG + Intergenic
976214894 4:82706820-82706842 GTAACTAGGACACACTGTGCAGG - Intronic
976337241 4:83904384-83904406 GTGTCTAGGAGCCACTATGTTGG + Intergenic
978605048 4:110470904-110470926 GTGGCTAAGAAACACTTTTCTGG + Intronic
980132985 4:128834041-128834063 GTGGCTAGTGTCCACTGTGTTGG + Intronic
980292594 4:130863157-130863179 GTGTCCTGGAACCAATGTGCTGG - Intergenic
982677551 4:158393445-158393467 GTGGCTAGTAGCAACAGTGCTGG - Intronic
982909201 4:161117982-161118004 GTGGCTTTGAAGCACTGTGGTGG + Intergenic
988698261 5:33646032-33646054 GTTCCAAGGAACCACTGTGCAGG + Intronic
991400217 5:66244144-66244166 GTGGATAGGAATCTCTGTGGGGG - Intergenic
999075702 5:148793291-148793313 GTCTCAAGGAACCACTGTGGGGG + Intergenic
1001104369 5:168840563-168840585 GTGGTCAGGATGCACTGTGCTGG - Intronic
1002770550 6:287119-287141 ATGGTTAGGACCCTCTGTGCAGG + Intergenic
1005695215 6:28345461-28345483 GTAGCCAGGCACCACTGAGCGGG - Intronic
1005811158 6:29517521-29517543 GTGACTAGGCACCACTGACCAGG - Intergenic
1009908289 6:69895109-69895131 GTGGCTGGGAACCAGTCAGCTGG + Intronic
1015320935 6:131873384-131873406 TTGGCTAAGAACCATTGTTCTGG + Intronic
1018624986 6:165769170-165769192 GTGGCTAATGACCACTGTTCTGG - Intronic
1019166868 6:170102971-170102993 GTGGAGAGGAAGCCCTGTGCAGG + Intergenic
1019191202 6:170251952-170251974 GTGGCTGGGACCCCATGTGCGGG - Intergenic
1019621251 7:1993270-1993292 GTGGGCAGGACCCACAGTGCAGG + Intronic
1019881041 7:3861414-3861436 GAGGGTAGTAATCACTGTGCAGG + Intronic
1023891500 7:44395260-44395282 GTGGCTAGCAGCTACTGTGCTGG + Intronic
1031519488 7:122746252-122746274 GTGGTTAGTGACCACTGTGTTGG - Intronic
1033137093 7:138794576-138794598 GTGGCTAGGCACCATGGTGGTGG - Intronic
1033402626 7:141041189-141041211 GAAGCTAAGATCCACTGTGCAGG - Intergenic
1034038801 7:147854623-147854645 GTGGCTAGGAACCACTGTGCTGG - Intronic
1037008536 8:13811186-13811208 GTGGCAAGTAGCCACTGTACTGG + Intergenic
1037209164 8:16364011-16364033 GTGGCTTAGAACAACTGTTCTGG - Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1040942263 8:52845466-52845488 GGGGCTAGGAACCAAAGTGGAGG + Intergenic
1043178821 8:77057805-77057827 GCTGCCAGGAAGCACTGTGCTGG + Intergenic
1043338339 8:79205006-79205028 GTGTCTAGGAGCCACTATGTTGG - Intergenic
1044710480 8:95052664-95052686 TGGGCTATGAACCACTGTTCTGG - Intronic
1044879358 8:96707235-96707257 GTGGCTAGTGACCACTGTATTGG - Intronic
1044957540 8:97496956-97496978 GAGGCTAGGAAGTACAGTGCTGG + Intergenic
1045371397 8:101527475-101527497 ATAGCTATGAGCCACTGTGCTGG + Intronic
1046721728 8:117627803-117627825 GTGGCCACTAACCACTGTGGTGG - Intergenic
1049243335 8:141549633-141549655 GTGGCTCAGAACCACTGGCCAGG + Intergenic
1049583759 8:143423779-143423801 GTGGCCAGGAACTGCTGAGCAGG + Intronic
1053666605 9:40322033-40322055 GTGACTAGGCACCACTGAACAGG - Intronic
1053916192 9:42947079-42947101 GTGACTAGGCACCACTGAACAGG - Intergenic
1054377757 9:64462061-64462083 GTGACTAGGCACCACTGAACAGG - Intergenic
1054518004 9:66054250-66054272 GTGACTAGGCACCACTGAACAGG + Intergenic
1057140787 9:92725727-92725749 GTTTCAAGGAGCCACTGTGCAGG + Intronic
1060530099 9:124342954-124342976 GGGGCTGGGAACCACAGGGCCGG - Intronic
1060856399 9:126917083-126917105 GGGGCCAGGAACCATGGTGCTGG + Intronic
1186283048 X:8014658-8014680 CTGGGTGGGAACCACTGAGCTGG + Intergenic
1186902123 X:14067960-14067982 GTGGCTAGTCACCACTGACCTGG + Intergenic
1187003957 X:15213442-15213464 GGGGCTAGTAGCCACTGTACTGG + Intergenic
1187203478 X:17158751-17158773 GGGGAAAGAAACCACTGTGCAGG + Intergenic
1188012750 X:25075039-25075061 GTGCTCATGAACCACTGTGCAGG + Intergenic
1189203899 X:39221367-39221389 GTGGCCAGGATCCACTGTGGTGG + Intergenic
1193882755 X:86944694-86944716 GTGGCTAGTGACTACTGTACTGG + Intergenic
1195073579 X:101304715-101304737 GTGGCTAGGACCCCCATTGCAGG - Intergenic
1196626611 X:117884445-117884467 GAGGCTAGGAAGCACAGTGGAGG + Intergenic
1198715369 X:139552649-139552671 GTGGCTAGTAACTACTGTATTGG + Intronic
1199684331 X:150253295-150253317 GTGACTAGTAGCCACTGTGTTGG + Intergenic