ID: 1034050458

View in Genome Browser
Species Human (GRCh38)
Location 7:147978600-147978622
Sequence TAATGGTGCCCTTAATTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034050458_1034050465 28 Left 1034050458 7:147978600-147978622 CCTCCTAATTAAGGGCACCATTA 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1034050465 7:147978651-147978673 TGTGCTTTATGTGCAGTCAGAGG 0: 1
1: 0
2: 1
3: 9
4: 167
1034050458_1034050462 5 Left 1034050458 7:147978600-147978622 CCTCCTAATTAAGGGCACCATTA 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1034050462 7:147978628-147978650 TTATGTTGTTTGATACCCTTCGG 0: 1
1: 1
2: 5
3: 50
4: 252
1034050458_1034050466 29 Left 1034050458 7:147978600-147978622 CCTCCTAATTAAGGGCACCATTA 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1034050466 7:147978652-147978674 GTGCTTTATGTGCAGTCAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034050458 Original CRISPR TAATGGTGCCCTTAATTAGG AGG (reversed) Intronic
905965572 1:42092622-42092644 TATTGATGCCCTTAATGGGGTGG - Intergenic
906159563 1:43637739-43637761 TATTGGTGCCTTTACTGAGGTGG + Intergenic
908424305 1:63990871-63990893 TAATAGTGCCTTATATTAGGAGG - Intronic
910293246 1:85618776-85618798 TAATGGGGCATTTAATGAGGTGG - Intergenic
911143950 1:94534873-94534895 TGAGGATGCCATTAATTAGGGGG + Intronic
913217166 1:116630245-116630267 TGATCTTGCCCCTAATTAGGAGG - Intronic
920143769 1:203841115-203841137 TTATGTTGCCCTAAATCAGGAGG - Intronic
1066607190 10:37190397-37190419 TCATGGTGCTCTTAATTTTGAGG + Intronic
1075881940 10:125860546-125860568 TCATGCTGCCCTTAAATAGGTGG - Intronic
1076355013 10:129846198-129846220 TGATGGTGCCTAAAATTAGGAGG + Intronic
1079450949 11:20599318-20599340 CCATGTTTCCCTTAATTAGGAGG + Intergenic
1086221512 11:84450597-84450619 TAATGGGGGCCTTAATTAGGGGG + Intronic
1086243519 11:84723262-84723284 TAATGCTGCCCTAGAATAGGAGG - Intronic
1092897378 12:13025839-13025861 TAATGGAGTCCTTAACTAGAAGG + Intergenic
1095551358 12:43444741-43444763 TCATGGTGCAGTTAACTAGGAGG - Intronic
1097323183 12:58247544-58247566 TCATGGTGCCTTCAGTTAGGCGG - Intergenic
1107113845 13:36725661-36725683 TGATGGTGGCCCAAATTAGGCGG + Intergenic
1112605245 13:100898012-100898034 TGATGGTGCAGTTAATTAAGAGG - Intergenic
1116574127 14:46551598-46551620 TTATGCTGCTCCTAATTAGGGGG - Intergenic
1117817681 14:59614233-59614255 AAATGGTACCCTTAATTTTGGGG + Intronic
1123477924 15:20604226-20604248 AAATGGCACCCTTAATTTGGGGG + Intergenic
1123640090 15:22396157-22396179 AAATGGCACCCTTAATTTGGGGG - Intergenic
1129134953 15:73540126-73540148 TAATGGAACCCTTGATTTGGGGG + Intronic
1134237401 16:12478020-12478042 TAATGGTGACCATCTTTAGGTGG - Intronic
1137530286 16:49275137-49275159 TAATTGTTGCCTTAATGAGGTGG - Intergenic
1140042109 16:71414992-71415014 AAATGCTGCTGTTAATTAGGAGG - Intergenic
1146949463 17:36895724-36895746 TATGGCTGCCTTTAATTAGGGGG - Intergenic
1151165697 17:72201765-72201787 TAATGAGGCCCTAAAGTAGGTGG - Intergenic
1159468307 18:68814033-68814055 TAGTGGTGCCTTTTATTAGTAGG + Intronic
1165101774 19:33442763-33442785 TAATGGTCCCCTTACTCAGAGGG + Intronic
925061876 2:897714-897736 TAATGCTGCAATGAATTAGGAGG + Intergenic
926473758 2:13295414-13295436 TAAAGGTGGGCTTAAATAGGAGG + Intergenic
938700621 2:133875933-133875955 AAATGGTACCCTTAATTTTGGGG - Intergenic
944183377 2:196921542-196921564 TAATGGTGTACTAAATTGGGAGG - Intronic
944519909 2:200555422-200555444 AAATGGGACCCTTAATTTGGGGG - Intronic
944944176 2:204664039-204664061 GAATAGGGCCCTTAATTGGGTGG + Intronic
945085181 2:206124342-206124364 TAATGGTGCACATATTCAGGAGG + Intronic
945780650 2:214167362-214167384 CAATGCTGCCAATAATTAGGTGG + Intronic
946948189 2:224843993-224844015 TAATGGAGCCAGAAATTAGGTGG + Intronic
1173861676 20:46287891-46287913 TAATGGTGGCTTGAAGTAGGTGG + Intronic
1176732595 21:10515280-10515302 TAATGGGTCCCTCAATTAGAGGG - Intergenic
1180818524 22:18808636-18808658 TGATTTTGCCCCTAATTAGGAGG - Intergenic
1181204747 22:21243091-21243113 TGATTTTGCCCCTAATTAGGAGG - Intergenic
1182502904 22:30760974-30760996 TGAAGATGCCCTTAATCAGGTGG - Intronic
1203222178 22_KI270731v1_random:52324-52346 TGATTTTGCCCCTAATTAGGAGG + Intergenic
1203268653 22_KI270734v1_random:34490-34512 TGATTTTGCCCCTAATTAGGAGG - Intergenic
953148763 3:40304793-40304815 CACTGGTGATCTTAATTAGGAGG - Intergenic
957467318 3:80610385-80610407 TAATAGTGCTCTTAAATAGTAGG - Intergenic
958968429 3:100585170-100585192 AAATGGCACCCTTAATTTGGGGG - Intergenic
960795608 3:121483802-121483824 TAATGCTCTACTTAATTAGGTGG + Intronic
971607419 4:28676030-28676052 TAATGGTGTTCTTAATTATGTGG + Intergenic
975358601 4:73439271-73439293 TTATGGTGGGGTTAATTAGGTGG + Intronic
978353552 4:107845616-107845638 TAATAGTGCCCCTAATTAAAGGG - Intronic
980886239 4:138765784-138765806 TAACAGTGGCATTAATTAGGGGG + Intergenic
985805471 5:2039667-2039689 TAGTGGTGCCCTGCCTTAGGGGG + Intergenic
987276683 5:16370543-16370565 GAATGGTGACCTTCAGTAGGGGG + Intergenic
988071923 5:26301930-26301952 TAAAGGTTCCCATGATTAGGTGG + Intergenic
988535017 5:32059758-32059780 AAATTGTGCCCTTGAATAGGAGG + Intronic
989412703 5:41139079-41139101 TAATGGGGCTCTTGATTAGTTGG - Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
994467876 5:100162091-100162113 AAATGGGACCCTTAATTTGGGGG - Intergenic
997798709 5:136838348-136838370 TAATGAGTCCCTTAATGAGGAGG + Intergenic
1000151891 5:158510849-158510871 TAATGGTGGCATGAAATAGGTGG + Intergenic
1013052872 6:106554223-106554245 TAATAGTGCCTTTAATCACGTGG + Intronic
1017302176 6:152874804-152874826 TAAAGGTGCCCTAAGGTAGGTGG + Intergenic
1021080586 7:16359314-16359336 TAATGATGCCATTATTTAGGGGG - Intronic
1021082951 7:16385158-16385180 TAATGGTGTCCTTTATTCTGCGG - Intronic
1024146858 7:46525513-46525535 AAATGATACCCTTAATTTGGGGG + Intergenic
1034050458 7:147978600-147978622 TAATGGTGCCCTTAATTAGGAGG - Intronic
1034596990 7:152206240-152206262 TAATGGGTCCCTCAATTAGAGGG + Intronic
1038778497 8:30551467-30551489 TAATGGTGCCCCCAGTCAGGAGG - Intronic
1040526452 8:48229395-48229417 AAATGGCACCCTTAATTTGGGGG + Intergenic
1043706326 8:83355845-83355867 AAATGGCACCCTTAATTTGGGGG - Intergenic
1044167066 8:88998674-88998696 TACTTGTGCCCTTAATAATGAGG + Intergenic
1044423512 8:92025496-92025518 GAATGATGGACTTAATTAGGCGG - Intronic
1050097061 9:2077743-2077765 TTAGGGTCCCATTAATTAGGAGG - Exonic
1051773286 9:20603711-20603733 TCATTGTGCCCTTAATTTGCAGG + Intronic
1055096228 9:72417153-72417175 TAATGGTTACATTAATTAGTTGG - Intergenic
1058015954 9:100032147-100032169 AAATGGGACCCTTAATTTGGGGG + Intronic
1186450218 X:9666161-9666183 AAATGGGACCCTTAATTTGGGGG + Intronic
1193193963 X:78607823-78607845 TAATGGTGCCATTAATCACTTGG - Intergenic