ID: 1034052879

View in Genome Browser
Species Human (GRCh38)
Location 7:148001289-148001311
Sequence CAGGCTGAAGGCTAGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034052879_1034052885 9 Left 1034052879 7:148001289-148001311 CCTGGGTCCTAGCCTTCAGCCTG 0: 1
1: 0
2: 2
3: 28
4: 302
Right 1034052885 7:148001321-148001343 ACAGCTCTTTGCGGATAACATGG 0: 1
1: 0
2: 0
3: 4
4: 82
1034052879_1034052884 0 Left 1034052879 7:148001289-148001311 CCTGGGTCCTAGCCTTCAGCCTG 0: 1
1: 0
2: 2
3: 28
4: 302
Right 1034052884 7:148001312-148001334 GCTCTCAGCACAGCTCTTTGCGG 0: 1
1: 0
2: 3
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034052879 Original CRISPR CAGGCTGAAGGCTAGGACCC AGG (reversed) Intronic
900623544 1:3598136-3598158 CAGGCTGTTGGCTGGGCCCCTGG - Intronic
900800021 1:4731705-4731727 CAGGCTGGAGCCCAGGTCCCAGG - Intronic
901470390 1:9452005-9452027 CAGGCTGAAGCCTAGGGGACGGG + Intergenic
901537662 1:9893061-9893083 CAGTCTGAAGGCAAGGACAGTGG + Intronic
901884026 1:12210179-12210201 CAGGCTGGAGGACAGGACCATGG - Intergenic
902171505 1:14615291-14615313 CAGGCTCGAGGCTAGAACCCAGG - Intronic
902257514 1:15199613-15199635 GCAGCTGAAGGCAAGGACCCTGG - Intronic
902417430 1:16248992-16249014 CTGGCTGAAAGCCAGGACCCAGG + Exonic
902533410 1:17105028-17105050 CAGGCTGAAGGTTTGGGCCCCGG + Exonic
902570838 1:17346202-17346224 CAGGCTGAACCCCAGGAGCCCGG - Intronic
903277980 1:22233625-22233647 GAAGCTGAAGGCTGGGACCATGG + Intergenic
903303150 1:22393180-22393202 CAAGCTGACGGCTGGGAGCCAGG + Intergenic
904169058 1:28578644-28578666 GAAGCAGAAGGCAAGGACCCCGG - Intergenic
904495312 1:30883264-30883286 CAGGCTGGGGGCCAGGAGCCCGG + Intronic
905005835 1:34709721-34709743 CAGGGCCAAGGCCAGGACCCTGG + Intergenic
905017584 1:34788142-34788164 CAGGCTGTGGGCCAGGACCATGG + Intronic
906520089 1:46461714-46461736 CAGGCTGTGGCCTTGGACCCGGG + Intergenic
907251200 1:53141118-53141140 CAGGCTGAAGACAAGGCCCAAGG - Intronic
907332848 1:53682509-53682531 CAGGCAGATGGCAAGGGCCCTGG + Intronic
908490965 1:64643743-64643765 CAGGAGAAAGGCTAGAACCCGGG + Intronic
908493168 1:64666777-64666799 GAGGCAGGAGGCTAGCACCCTGG + Intronic
909475264 1:76074779-76074801 CAGGCTGGAGGCTGGTACCACGG - Exonic
910734691 1:90440525-90440547 CAGACTCAAGGCTAGGACTCAGG - Intergenic
912438919 1:109683361-109683383 CAGGAAGAAGGCCAGGCCCCAGG - Intronic
912441441 1:109701806-109701828 CAGGAAGAAGGCCAGGCCCCAGG - Intronic
912517938 1:110227557-110227579 CAGGCCCAAGGATAGGACACGGG - Intronic
912764391 1:112395978-112396000 CACCCTGAAGCCCAGGACCCAGG + Intergenic
914356368 1:146887941-146887963 CAGGGTGAAGACTAGAACCCTGG + Intergenic
915310992 1:155005724-155005746 CAGGCAGATGGATAGGACCCTGG + Intronic
915938758 1:160104988-160105010 CAGTCTGAAGGCCAGGACATTGG + Intergenic
919835540 1:201570647-201570669 CTGGCTGAGGGCTACGACCAGGG + Intergenic
922778761 1:228232994-228233016 CAGGATGAAGACCAGCACCCTGG - Intronic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1067297659 10:44984058-44984080 CTGGCTGAATGCTTGGCCCCTGG - Exonic
1068034663 10:51744459-51744481 CAGAATGAAGACTAGGGCCCAGG + Intronic
1068186826 10:53595547-53595569 CAGGCTAAAAGCTAGGAGCCAGG + Intergenic
1069714886 10:70514261-70514283 CAGGCTGAAGGCTGGAAGTCAGG + Intronic
1070024659 10:72620993-72621015 CAGGCGGAATGCTTGAACCCAGG + Intronic
1071470556 10:85981145-85981167 CAGGCTCCAGGCTCTGACCCAGG + Intronic
1072742865 10:97920659-97920681 CAGGCCCTAGACTAGGACCCGGG - Intronic
1072791408 10:98320948-98320970 CAGGCTCCAGGCTAGGCCCTGGG + Intergenic
1073247441 10:102101578-102101600 CAGCATGAAAGCTAGGACCTTGG - Intergenic
1073291920 10:102417324-102417346 CAGGCAGAAGGAAAGGAGCCAGG - Intronic
1074230566 10:111531152-111531174 CAGGCAGAACACTAGGACCTGGG + Intergenic
1074504377 10:114055271-114055293 CAGGCTGAAGGCTTGAGTCCGGG - Intergenic
1074974119 10:118566641-118566663 CAGGGAGAAGGCTAGGGCCTGGG + Intergenic
1075339994 10:121639300-121639322 CAGGAGGAAGGCTAGAACCCAGG - Intergenic
1078248984 11:9601756-9601778 GAGGCAGAAGGCTTGGATCCCGG + Intergenic
1079203401 11:18394313-18394335 CAGGCTCATGGCTCCGACCCCGG + Intergenic
1079710726 11:23680003-23680025 GAGCCTGAAGGCTGGGGCCCGGG - Intergenic
1081663071 11:44900230-44900252 CAGGCTGAAGCCTAGAGACCAGG - Intronic
1081852795 11:46285400-46285422 CAGACTGAATGGCAGGACCCTGG + Intronic
1082824493 11:57567820-57567842 CGCGCGGAAGGCTCGGACCCGGG + Intronic
1083770465 11:64864205-64864227 CAGGCTGGAGGCCAGGACCCCGG - Intronic
1084389449 11:68865579-68865601 CAGGATGAAGGACAGGACTCCGG + Intergenic
1084490768 11:69476930-69476952 CAGGCTGAAGGCTCGGGCTCGGG + Intergenic
1084492156 11:69484762-69484784 CAGACTGAAGACGAGGCCCCAGG - Intergenic
1084972296 11:72778554-72778576 CAGGAAGGAGGCTGGGACCCTGG - Intronic
1085200190 11:74697150-74697172 CAGGAAGAAGGCAAGGACACGGG - Intronic
1088637482 11:111837187-111837209 CTGGCAAAAGCCTAGGACCCAGG + Intronic
1090335036 11:125956354-125956376 CAGGCTGATGGCTGGGTCCCAGG + Exonic
1091409689 12:231107-231129 CAGGCACAGGGCCAGGACCCGGG + Intronic
1091515564 12:1177292-1177314 CAGGCTGAAAGCTAGGCCTCTGG - Intronic
1091831238 12:3552581-3552603 CAGCCTGAAGGCCAGGGACCTGG + Intronic
1091883537 12:3999385-3999407 CAGGGTTAAGGGTAGGAGCCAGG + Intergenic
1096095722 12:48934360-48934382 CTGGCGGAAGACTTGGACCCAGG - Intronic
1096572927 12:52534021-52534043 CAGGCTGCAGGCCAGGAGCTGGG + Intergenic
1097188357 12:57207923-57207945 CAGGCTCACAGCCAGGACCCTGG - Intronic
1098092617 12:66920363-66920385 CAGGTTGATGGCAAGGACCAGGG - Intergenic
1099363820 12:81743047-81743069 CAGGCTGAATGCCTGAACCCAGG + Intronic
1100483312 12:95001211-95001233 CAGGAGGAAGGCTAGAACCCAGG + Intronic
1100494451 12:95111453-95111475 AAGGCAGAAGCCCAGGACCCAGG + Intronic
1101637899 12:106561344-106561366 CAGGCTTCAGGCCATGACCCTGG + Intronic
1101820957 12:108184031-108184053 AAGGCTGAAGGCTGGGATGCAGG + Intronic
1102359776 12:112274944-112274966 CAAGCTGGAGGCTAGGACTTTGG + Exonic
1103904825 12:124321839-124321861 CAGGCAGAATTCCAGGACCCTGG + Intergenic
1103953172 12:124562803-124562825 CAGCCTGTAGGTGAGGACCCGGG + Intronic
1104080520 12:125426574-125426596 CTGGCTGAGGGCTATGTCCCTGG + Intronic
1104601081 12:130153931-130153953 TAGGCTGGTGGCTTGGACCCCGG - Intergenic
1104856988 12:131906954-131906976 CAGGCTGATGGCCATGGCCCTGG + Intronic
1105435406 13:20373186-20373208 AAGACTAAAGGCTATGACCCAGG + Intergenic
1106021939 13:25924031-25924053 CAGGCTGAAGGGTAGCTTCCTGG - Intronic
1106507244 13:30381862-30381884 CAGGCTGAAGTCTGAGACCACGG + Intergenic
1107099565 13:36575007-36575029 CAGGATAAATGCTAGGACCATGG + Intergenic
1112490493 13:99858988-99859010 CAGGCTGGAAGGAAGGACCCGGG - Exonic
1113149844 13:107251543-107251565 CAGGCTGAAGCCTCGGAGACGGG + Intronic
1113926889 13:113946730-113946752 CAGGGTGGAGGGGAGGACCCAGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1118730944 14:68665879-68665901 CAGGGTGAAGCACAGGACCCAGG + Intronic
1119718661 14:76876376-76876398 GAGGCTGAAGGCTATGGCCCAGG - Intergenic
1120001235 14:79305596-79305618 CAGAATGAGGGCTAGAACCCCGG + Intronic
1120840140 14:89078321-89078343 CAGGCTGAGTGCTTGGAGCCGGG - Intergenic
1122929309 14:104926118-104926140 CAGGCTGGGCGCTGGGACCCAGG - Intronic
1122940951 14:104981161-104981183 CAGGCTGAGGGGCAGGACCAGGG - Intergenic
1122942402 14:104987358-104987380 GGGCCTGAAGGCTGGGACCCTGG - Intronic
1122967182 14:105136823-105136845 CCGGCTGCAGGCTGGGAACCTGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1123587537 15:21772924-21772946 CACGTGGAAGGCCAGGACCCTGG + Intergenic
1123624175 15:22215489-22215511 CACGTGGAAGGCCAGGACCCTGG + Intergenic
1123992625 15:25694825-25694847 CAAGCTCAAGGCCATGACCCTGG - Exonic
1124631188 15:31338605-31338627 CAGGATGGAGGGTGGGACCCTGG + Intronic
1126843208 15:52736933-52736955 CAGGCAGATGGCTTGAACCCAGG - Intergenic
1128429765 15:67580552-67580574 CAGGGTGAAGGCTAACACACTGG + Intronic
1128472494 15:67967158-67967180 CAGGCGGATGGCTTGAACCCAGG - Intergenic
1128939415 15:71775616-71775638 CAGGAGAAAGGCTTGGACCCGGG + Intronic
1128988635 15:72240268-72240290 CAGGCAGATGGCTTGGGCCCAGG + Intergenic
1129805017 15:78448687-78448709 CCTGCTGAAGGCTAGGGGCCTGG - Intronic
1129904029 15:79173323-79173345 CAGCCTGGAGGCCAGGACACGGG + Intergenic
1129939047 15:79478039-79478061 CAGGTTGATGGCTAGGAGTCAGG - Intergenic
1130106405 15:80931954-80931976 CAGGCGGAAGGCCAGGGCGCTGG - Exonic
1130562509 15:84969622-84969644 CAGGCTGCAGGAAATGACCCAGG + Intergenic
1131231902 15:90665632-90665654 CAGGCTGAACGCTGGAGCCCGGG - Intergenic
1132643651 16:989087-989109 CAGACAGCAGGCCAGGACCCCGG - Intergenic
1132713620 16:1279927-1279949 CAGGCAGGAGGCAAGGTCCCTGG + Intergenic
1132813984 16:1817308-1817330 GAGGCTGGTGGCTAGGACTCAGG + Intronic
1132884778 16:2177869-2177891 CAGGTGGAAGGCTGGGGCCCGGG - Exonic
1133494041 16:6299151-6299173 CAGGCTGAATACTAGCACCATGG + Intronic
1137291145 16:47052828-47052850 CTGGCTCAAGGCCAGGACCTGGG - Intergenic
1137305721 16:47197730-47197752 AAGGCTGAGGGCTTGGAGCCAGG + Intronic
1137628254 16:49923039-49923061 GAGCCTAAAAGCTAGGACCCAGG + Intergenic
1137669815 16:50272464-50272486 CAGGGAGAAGCCTAGCACCCTGG + Intronic
1138448908 16:57081337-57081359 AAGGCTGAAGGCTAGAACCCAGG - Intronic
1139565240 16:67771033-67771055 CAGGCTGATGGCTTGAGCCCAGG + Intronic
1139977648 16:70827522-70827544 CAGGGTGAAGACTAGAACCCTGG - Intronic
1140265869 16:73420133-73420155 CAGGCTGATGGCTTGAGCCCAGG - Intergenic
1140611737 16:76608008-76608030 CATGCTGAAAGCTAGGAGCTGGG + Intronic
1141420882 16:83914684-83914706 CAGGAGGATGGCTTGGACCCAGG + Intronic
1141800028 16:86301192-86301214 CAGGCTGCAGGCATGGACGCTGG - Intergenic
1141826807 16:86486369-86486391 CAGGCTGCAGCCTGGGACTCAGG + Intergenic
1142009955 16:87708924-87708946 AAGGCTGGAGGCTCAGACCCAGG + Intronic
1142161111 16:88558334-88558356 CAGGATGAACGCTTGAACCCAGG - Intergenic
1142173143 16:88633307-88633329 CAGGCTGCAGGCTGGCACCCAGG - Intergenic
1142185321 16:88692109-88692131 CAGGAGGAAGTCTAGTACCCAGG - Intergenic
1143179206 17:4973750-4973772 CAGGATGAAGGCCAGGGGCCTGG - Exonic
1145090285 17:19980264-19980286 TTGGCTGAAGCCAAGGACCCGGG + Intergenic
1146006103 17:29161743-29161765 CAGGCTGGAGACTAGGGCCTGGG - Intronic
1146255688 17:31390753-31390775 CAGGCTCTAGGTCAGGACCCTGG - Intergenic
1146383932 17:32352786-32352808 CAGGAAGACGGCTAGAACCCAGG - Intronic
1147668893 17:42165470-42165492 CAGGTTGAAGGTGAGGTCCCGGG + Exonic
1149646703 17:58246421-58246443 GAGGATGATGGCTAGGACCGCGG + Intronic
1149684764 17:58528973-58528995 CAGGCAGGAGGTGAGGACCCTGG - Intronic
1150003481 17:61456019-61456041 CAGGCTGGAGGGCAGGGCCCAGG - Intronic
1150160239 17:62891642-62891664 CAGGCAGAAGGTTAGGCCCTTGG + Intergenic
1151926619 17:77202256-77202278 CAGGAGGATGGCTTGGACCCAGG + Intronic
1152363428 17:79842622-79842644 CAGGCTGAAGGAGTGGACCCTGG + Intergenic
1154154481 18:11933191-11933213 CAGGAGGAAGGCTTGAACCCAGG - Intergenic
1156299378 18:35822560-35822582 TAAGCAGAAGGCTAGGAGCCAGG - Intergenic
1161881124 19:6953648-6953670 CAGCCTGAATGCTAAGACCATGG - Intergenic
1162392596 19:10398461-10398483 GTGGCTGTGGGCTAGGACCCAGG - Intronic
1163838487 19:19591246-19591268 CAGGGTGACTGCTAGGACCCAGG + Intronic
1164753154 19:30670784-30670806 CGGGCTGAAGGGATGGACCCGGG - Intronic
1166130035 19:40740535-40740557 CAGGCTGCAGGCCAGGGTCCTGG - Exonic
1166315700 19:41988288-41988310 CAGGCTGTGGGCTGGGACCCTGG - Intronic
1167020090 19:46867451-46867473 CAGGGCTAGGGCTAGGACCCAGG - Intergenic
1167071128 19:47222482-47222504 CAGGCAGGAGGCTAGGTCCTAGG + Intronic
1167120674 19:47514666-47514688 CAGGCTGAGGGCCAAGAGCCTGG - Intronic
1167383885 19:49153087-49153109 CAGACTGAAGGCTGGGAGGCTGG - Intronic
1168298308 19:55388687-55388709 CAGGCTGAGGGCTGGGCCCTGGG + Intronic
925017586 2:543642-543664 CAGGCTGGAGGGTAGGAGGCAGG + Intergenic
926384373 2:12321706-12321728 CAGGCTCAATGCTAGGTCCTGGG + Intergenic
926729737 2:16027175-16027197 CAGGCTGAAGGCAAGGGCTCTGG - Intergenic
927427391 2:22996199-22996221 CAGATTGAGGGCTAGAACCCGGG - Intergenic
927679416 2:25130130-25130152 CAGGCTGAAGGCTGGGGCCAAGG - Intronic
928240676 2:29582953-29582975 CAGGCTAAAGGCTTGAACCCAGG - Intronic
929179911 2:39026591-39026613 TAGGCTGAAGGCTGGAATCCAGG + Intronic
933842928 2:86302172-86302194 CAGGCTGGAGTCTGGGACCCGGG - Intronic
934117612 2:88811794-88811816 CAGGCAGGAGGCTAGGAGGCAGG - Intergenic
935742419 2:106161331-106161353 CAGGCTGATGGCTTGAGCCCAGG - Intronic
937087703 2:119182243-119182265 CAGACTGCAGGCTGGGAGCCGGG + Intergenic
937121729 2:119445178-119445200 CATGCTGAGAGCTTGGACCCGGG - Intronic
937276245 2:120685896-120685918 CGGGTGGAAGGCTATGACCCTGG + Intergenic
937326020 2:120989928-120989950 CAGGCAGAAGGCTGGGGACCTGG - Exonic
939665892 2:144950917-144950939 CAGGCGAATGGCTAGAACCCAGG - Intergenic
941020440 2:160402750-160402772 CATGGTGAAAGCTAGGTCCCTGG - Intronic
942033784 2:171990638-171990660 CAGGCTGATCGCTTGAACCCAGG - Intronic
943635741 2:190304954-190304976 GAGACTTAAGGCTAGAACCCAGG - Intronic
943985787 2:194616419-194616441 CAGGTCGAAGGCTAGGCCTCTGG - Intergenic
944218228 2:197276867-197276889 CAGGCTGGAGCCTAGGCACCTGG - Intronic
945593143 2:211759296-211759318 CAGGGTGGAAGCTAGGACACCGG - Intronic
947778408 2:232734175-232734197 CAGGCAGACGGCTTGGGCCCAGG - Intronic
947814386 2:233026182-233026204 CAGGAGGATGGCTTGGACCCTGG + Intergenic
947992364 2:234497361-234497383 CAGGGGGCGGGCTAGGACCCGGG - Intergenic
1168828948 20:833880-833902 GAGGCTGACAGCTCGGACCCGGG - Exonic
1170314945 20:15031815-15031837 CAGCCTGAAGCCTGGGAGCCAGG - Intronic
1170439309 20:16362223-16362245 CATGCTGAATGCTAAGGCCCAGG + Intronic
1170534981 20:17331864-17331886 AAACCTGTAGGCTAGGACCCTGG + Intronic
1171045558 20:21806911-21806933 CAGGCAGGAGGCTAGAACACTGG - Intergenic
1171285997 20:23938423-23938445 CAGCCTGAAGCCTTGGAACCAGG + Intergenic
1172120806 20:32597677-32597699 CAGACCCAGGGCTAGGACCCAGG - Intronic
1172645885 20:36469300-36469322 CAGGATGCAGGTTAGGAGCCTGG - Intronic
1174193979 20:48759875-48759897 CAGGCTGATTGCTTGAACCCAGG + Intronic
1174280577 20:49435965-49435987 CAGGCTGAGGTCTAGAGCCCAGG - Intronic
1174396251 20:50248408-50248430 CAGGCCCAAGGATGGGACCCTGG - Intergenic
1175169270 20:57068607-57068629 CAGGCTGCAGGCTATGAGGCAGG + Intergenic
1176737242 21:10561813-10561835 CATCCTGAAGGCAAGGACACAGG + Intronic
1176962415 21:15174218-15174240 CAGGCTGATGGCTTGAGCCCAGG - Intergenic
1177603395 21:23345575-23345597 CAGGCTGATGGCAACGATCCTGG - Intergenic
1180156366 21:45979316-45979338 CAGGATGAAGCCTGGGACCGGGG + Intergenic
1180748233 22:18106908-18106930 CTGTCTGAAGGCTGAGACCCAGG + Intronic
1181572795 22:23776777-23776799 CTGGTTGCAGGCTAGGACCTTGG - Intronic
1181765649 22:25090040-25090062 CAGGCTGGAGCCCAGGAGCCAGG - Intronic
1182420157 22:30245071-30245093 CAGAGTGAAGACTAGGCCCCAGG - Intronic
1182481351 22:30610989-30611011 CAGTCTGCAGGCTGGGACCAAGG + Exonic
1183474714 22:38029795-38029817 CTTGGTGAAGGCTAAGACCCTGG - Intronic
1183906381 22:41043974-41043996 TAGCCTGATGCCTAGGACCCAGG + Intergenic
1183963885 22:41429612-41429634 CAGACAGAAGGCTAGGCCCCTGG + Intergenic
1184257871 22:43297265-43297287 GAGGCTGGAGGCTGAGACCCAGG - Intronic
1185362823 22:50419216-50419238 CAGGCTCAAGGCAAGGCGCCAGG - Intronic
949866397 3:8550953-8550975 CTGACTGTAGGCAAGGACCCGGG - Intronic
950521328 3:13499693-13499715 CAGACTGAATGCTAGGCACCTGG - Intronic
951291487 3:20876478-20876500 CAGGCTGGAGGATAGGAGGCAGG + Intergenic
951862409 3:27267867-27267889 CAGGCTGAAAGTTAGGCCTCTGG + Intronic
953553225 3:43921322-43921344 CAGGCAGAAAGCTAGGAAACGGG - Intergenic
954133508 3:48571635-48571657 CAGGCTGAACGCTGGCAGCCAGG + Intronic
954382844 3:50228687-50228709 CAGGCTGTGGGCTAGTACCAGGG - Intronic
954409112 3:50362217-50362239 GAGCCTGAAAGCCAGGACCCTGG - Intronic
954917574 3:54162072-54162094 CGGTCTGAAGGCGAGGACACTGG + Intronic
955771558 3:62389831-62389853 TCGGCTGAAGGCTGGGACACAGG + Intergenic
956265341 3:67390246-67390268 GAGACTGATGGCAAGGACCCTGG - Intronic
956665679 3:71639892-71639914 GAGGGTGAAGGCTTGAACCCAGG - Intergenic
959037472 3:101383887-101383909 CAGCCTGAAGTCTGGGGCCCAGG + Intronic
960561004 3:119084254-119084276 GAGGCTGAAGGCAAGGAAGCTGG + Intronic
961220192 3:125193585-125193607 CAGGCTGAGGGGCAGGACCACGG + Intronic
961256344 3:125557216-125557238 CAACATGAAGGCTAGGACCATGG + Intronic
961389785 3:126545635-126545657 CAGGGTGAAGGCAAGGCCCAGGG + Intronic
961474745 3:127139759-127139781 CAGGCAGATGGCCAGGAGCCTGG - Intergenic
961521138 3:127467930-127467952 CAAGCTGCAGGCCAGGTCCCTGG + Intergenic
963893567 3:150661786-150661808 CAGGATGATGGCTTGAACCCAGG + Intronic
966557815 3:181283664-181283686 CAGGCTTAATCCTAGGACCTTGG - Intergenic
966770808 3:183501683-183501705 CAGGCAGCAGGCAGGGACCCAGG - Intronic
967897496 3:194410230-194410252 CAGGCAGATGGCTTGAACCCAGG + Intronic
968038796 3:195571209-195571231 CAAACTGAAGGCTAGCGCCCCGG - Intronic
968127474 3:196170282-196170304 CAGGAGGACGGCTTGGACCCAGG + Intergenic
969232226 4:5839776-5839798 CTGGCTGAAGGCCAGAACACTGG + Intronic
969569724 4:8001397-8001419 CCGGCTGAAGGCTAGTCCCCAGG + Intronic
970133562 4:12897197-12897219 CAGGTTGAGGGCTAGAACCTGGG - Intergenic
972931060 4:44072065-44072087 GAGCCTGAAGGCTGGGAACCCGG - Intergenic
974103863 4:57445655-57445677 CAGGCAGGAGGCTTGGATCCTGG + Intergenic
975471378 4:74772913-74772935 CAGGCTGGGGGCTATGGCCCAGG + Intronic
976315827 4:83657681-83657703 CAGGCTGAAGTCTAGGGATCAGG + Intergenic
977389736 4:96392142-96392164 CAGGGTGAATGCAATGACCCAGG - Intergenic
978130550 4:105191112-105191134 CAGGATGATGGCTTGAACCCAGG - Intronic
978994748 4:115136819-115136841 CAGGAGGATGGCTAGAACCCAGG + Intergenic
979520846 4:121665023-121665045 CAGGCTGAAAGCTAGGCTACTGG - Intergenic
979711961 4:123790318-123790340 GAGCCAGAAGGCTAGAACCCTGG + Intergenic
981641121 4:146945058-146945080 CAGGCTGAAGTCTATAAGCCTGG - Exonic
983523694 4:168738061-168738083 AAAGCTGAAGGCTAGGACAAAGG - Intronic
984856588 4:184200817-184200839 CAGGCTGAGTGCTAGGGACCAGG - Intronic
984871882 4:184332893-184332915 CAGGCTGAAGCCTGGGTCCAGGG - Intergenic
985270319 4:188188223-188188245 CAGGCTGAAGTGCAGGACCTTGG + Intergenic
985547084 5:515168-515190 CAGGCTGATGGCATGGACTCTGG - Intronic
985695119 5:1335769-1335791 CAGGCTGTGGGCCAGGTCCCAGG + Intronic
985783355 5:1882094-1882116 CGGGCTGGAGGCTGGGGCCCTGG + Intronic
988962883 5:36387141-36387163 CAGGAAGAAGGCTAGGAACAGGG - Intergenic
989116179 5:37955152-37955174 AGGGCTGAAGACTAGAACCCAGG - Intergenic
990135498 5:52639586-52639608 AAGGATGAAGGATAGGAGCCAGG - Intergenic
997467918 5:134100514-134100536 GAGGCTGCAGGCTGGGTCCCAGG - Intergenic
999305240 5:150515420-150515442 GAGGCTGAAAACCAGGACCCTGG - Intronic
1001102297 5:168824432-168824454 CAGGCTATAGGCAAGTACCCGGG + Intronic
1001264766 5:170265897-170265919 CAGGCTGCAGTTGAGGACCCTGG - Intronic
1001722241 5:173866496-173866518 CAGGAAGCAGGCGAGGACCCTGG + Intergenic
1002605082 5:180378209-180378231 CAGGAGCCAGGCTAGGACCCAGG - Intergenic
1004892293 6:20112957-20112979 CAGGATGAAGGTTAGCACCGTGG + Exonic
1006169958 6:32087037-32087059 CAGGATGGATGCCAGGACCCTGG + Intronic
1006463800 6:34179094-34179116 CAGCCTGAAGTCTAGGGGCCAGG - Intergenic
1006843521 6:37047410-37047432 CAGGCTGCAGGTTTGCACCCTGG + Intergenic
1007121020 6:39381529-39381551 TGGGCTGAAGGCTAGGACAGAGG - Intronic
1007594180 6:43041376-43041398 CAGGCAGATGGCTTGAACCCAGG + Intronic
1008091167 6:47295135-47295157 CAGGGTGAATGCTGAGACCCAGG - Intronic
1012959756 6:105609887-105609909 CAGGGTGATGGCGAGGACACAGG + Intergenic
1015506970 6:133998766-133998788 CAGGCAGAACGCTTGAACCCAGG - Intronic
1015959527 6:138632298-138632320 CACCCTGAAGGCAAGGACACAGG + Intronic
1018268987 6:162055674-162055696 AAGGCAGAAGGTTAGGACTCAGG + Intronic
1019542704 7:1558754-1558776 CAGGCTCAGGGCTTGGGCCCCGG + Intronic
1019756618 7:2775624-2775646 CAGGCTGTTGGGTAGGACACAGG - Intronic
1020208158 7:6135556-6135578 CAGGCAAATGGCTTGGACCCGGG + Intronic
1021313644 7:19119168-19119190 CAAGCTGAAGGCAAGAGCCCAGG + Intergenic
1021918264 7:25456831-25456853 CAGGCTGAAATCTGGCACCCAGG + Intergenic
1022516904 7:30980758-30980780 CAGGCAGTATGCTGGGACCCAGG - Intronic
1023632829 7:42180572-42180594 AAGGCTGGAGGGTAGGACCCAGG + Intronic
1023756114 7:43418267-43418289 TATGCTGAAGTCTAAGACCCTGG - Intronic
1024083748 7:45876804-45876826 CAGGCTCTAGGCTTGGACCCAGG - Intergenic
1024479997 7:49853091-49853113 CAGGCTGAAGGCAGGCTCCCAGG + Intronic
1024786128 7:52910360-52910382 TAGGCTGAAAGCTAGGCCTCTGG - Intergenic
1025825319 7:65006347-65006369 CGGGCTGACAGCTCGGACCCCGG - Intronic
1027787191 7:82594998-82595020 CAGACTGAAGGGTAGGACTGTGG + Intergenic
1030229911 7:107196870-107196892 CAGGCAGATGGCTTGAACCCAGG - Intronic
1030270314 7:107662240-107662262 CAGGATGCAAGCTAGAACCCAGG + Intronic
1030615019 7:111729697-111729719 CATGCTGCAGGCCAGGAGCCAGG + Intronic
1031071988 7:117172041-117172063 CAGGAGGATGGCTAGAACCCAGG - Intronic
1031538323 7:122961814-122961836 CAGGCTCAAGGCTAGGACAGGGG + Intergenic
1034052879 7:148001289-148001311 CAGGCTGAAGGCTAGGACCCAGG - Intronic
1034589131 7:152124655-152124677 AAGGCTGAAGGCTGAGGCCCAGG - Intergenic
1035581606 8:743790-743812 TAGGCTGATGGCTAGAGCCCAGG - Intergenic
1036659025 8:10695835-10695857 CATGCTGTAGGCAAGGAGCCGGG - Intronic
1037816701 8:22116323-22116345 CAGGGGGAAGGCTGGGTCCCTGG + Exonic
1038421351 8:27436033-27436055 CCCTCTGAAGGCTAGGTCCCAGG - Intronic
1038695399 8:29801922-29801944 CATCCTAAAGGCTAGAACCCTGG - Intergenic
1042140398 8:65673045-65673067 CAGGCTGAAAACTAGGTCTCTGG - Intronic
1042409814 8:68451395-68451417 TAGGCTGAAAGCTAGGCCTCTGG - Intronic
1042555232 8:70028780-70028802 CAGGATGATGGCTATGTCCCAGG - Intergenic
1044890764 8:96832927-96832949 CAGGCTGGAGGCTGGCACACCGG + Intronic
1045339860 8:101243878-101243900 CAAGCAGAAGTCCAGGACCCTGG - Intergenic
1048004988 8:130411905-130411927 CAGGGTGGAGGCTGGGACACTGG - Intronic
1049277626 8:141727863-141727885 CAGGCTGAGGGCCAGGCCACTGG - Intergenic
1052072562 9:24100286-24100308 CAGCCTGAAGCCTAGGTCCATGG - Intergenic
1052199460 9:25760786-25760808 CAGGCTGATGGCTTGAGCCCAGG - Intergenic
1052897436 9:33760821-33760843 CAGCATTCAGGCTAGGACCCAGG + Intronic
1054921519 9:70547705-70547727 CAGTCTAAAGCCTAGGACACAGG + Intronic
1057481493 9:95448417-95448439 CAGGGTGGAGGAAAGGACCCAGG + Intronic
1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG + Intronic
1059773047 9:117445735-117445757 CGGGCTCAAGGCCTGGACCCAGG + Intergenic
1059915158 9:119091305-119091327 CAGGCTGGTGACTATGACCCAGG + Intergenic
1060597702 9:124858083-124858105 CAGGGTGAATCCAAGGACCCAGG + Intronic
1060706067 9:125802594-125802616 CAGGCGGATGGCTTGAACCCAGG - Intronic
1060939523 9:127535549-127535571 AAGGCTGAAGGTCAGGTCCCTGG + Intronic
1061631002 9:131872134-131872156 CAGGCTGGGGACCAGGACCCAGG + Intronic
1062083376 9:134636181-134636203 CAGGCTGCAGGCTTGGACTGGGG + Intergenic
1062538897 9:137032837-137032859 CAGGCTGGAGGAAGGGACCCTGG - Exonic
1062736504 9:138140418-138140440 GAGGCAGGAGACTAGGACCCCGG - Intergenic
1185459458 X:328154-328176 CACGTGGAAGGCCAGGACCCTGG - Intergenic
1187524353 X:20040453-20040475 TGGGCTGAAGGCTAGGCCTCTGG - Intronic
1188262583 X:28037503-28037525 CATCCTGAACTCTAGGACCCTGG - Intergenic
1188321608 X:28745221-28745243 CAGCCTTTAGGGTAGGACCCAGG + Intronic
1191636085 X:63378803-63378825 TAGGCTGAAGACAAGGACCAAGG - Intergenic
1192836205 X:74802139-74802161 CACCCTGAAGGGTAGGACACAGG + Intronic
1195199989 X:102539446-102539468 CATCCTGAAGGGTAGGACACAGG - Intergenic
1195211316 X:102654021-102654043 CAGACCCAAGGTTAGGACCCAGG + Exonic
1195217465 X:102714977-102714999 CAGACCCAAGGTTAGGACCCAGG + Exonic
1195704532 X:107729394-107729416 CAGGCAGAAGGGCAGGACGCTGG + Intronic
1198361891 X:135903472-135903494 CAGGCAGCATGCCAGGACCCAGG - Intronic
1199050653 X:143232858-143232880 CACCCTGAAGGAAAGGACCCAGG + Intergenic
1199850225 X:151720965-151720987 CAGGGCTAAGGCTAGAACCCTGG - Intronic