ID: 1034054081

View in Genome Browser
Species Human (GRCh38)
Location 7:148016169-148016191
Sequence CAAAGGACGTGGAGATTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034054081_1034054087 -10 Left 1034054081 7:148016169-148016191 CCTGCCAATCTCCACGTCCTTTG 0: 1
1: 0
2: 2
3: 15
4: 143
Right 1034054087 7:148016182-148016204 ACGTCCTTTGTAGAGGACCGGGG 0: 1
1: 0
2: 0
3: 3
4: 25
1034054081_1034054091 13 Left 1034054081 7:148016169-148016191 CCTGCCAATCTCCACGTCCTTTG 0: 1
1: 0
2: 2
3: 15
4: 143
Right 1034054091 7:148016205-148016227 TGGACATGCCCATCCCCTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 178
1034054081_1034054093 15 Left 1034054081 7:148016169-148016191 CCTGCCAATCTCCACGTCCTTTG 0: 1
1: 0
2: 2
3: 15
4: 143
Right 1034054093 7:148016207-148016229 GACATGCCCATCCCCTCCTGGGG 0: 1
1: 1
2: 2
3: 22
4: 205
1034054081_1034054088 -7 Left 1034054081 7:148016169-148016191 CCTGCCAATCTCCACGTCCTTTG 0: 1
1: 0
2: 2
3: 15
4: 143
Right 1034054088 7:148016185-148016207 TCCTTTGTAGAGGACCGGGGTGG No data
1034054081_1034054092 14 Left 1034054081 7:148016169-148016191 CCTGCCAATCTCCACGTCCTTTG 0: 1
1: 0
2: 2
3: 15
4: 143
Right 1034054092 7:148016206-148016228 GGACATGCCCATCCCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034054081 Original CRISPR CAAAGGACGTGGAGATTGGC AGG (reversed) Intronic
903160994 1:21489088-21489110 CACAGGACTTGGAGATGGTCTGG + Intergenic
903325837 1:22568069-22568091 CAAGGGACATGGAGAGAGGCAGG + Intronic
904914410 1:33959667-33959689 CAAAGGGCTTTGAGTTTGGCAGG - Intronic
905382746 1:37574926-37574948 CAAAGCTCGTGGAGATTGGCAGG + Intronic
905558723 1:38909022-38909044 CGGAGGACGCGGAGTTTGGCTGG - Intronic
906500627 1:46339799-46339821 CAAAAGGCAGGGAGATTGGCTGG + Intergenic
907379449 1:54073879-54073901 CAAAGGACTTGTAGATTGATTGG + Intronic
912158959 1:106957424-106957446 CATAGGCCTTGGAGATAGGCAGG - Intergenic
913269797 1:117081970-117081992 CAAATGACGTAGGGAATGGCAGG - Intronic
915610313 1:156986605-156986627 CAAAGGAAGGGGAGACTGGAGGG + Intronic
918809271 1:189094373-189094395 GAGAGGAGGTGGAGTTTGGCAGG + Intergenic
919756432 1:201069022-201069044 GAAAAGAGGTGGAGACTGGCAGG - Intronic
921681734 1:218041395-218041417 CATAGGAGTTGGAGATTGACTGG + Intergenic
921890990 1:220353398-220353420 GAAACGACGTGGAGTTTGGTCGG + Intergenic
923231678 1:231992289-231992311 CAAATCACGTGTTGATTGGCTGG + Intronic
924589026 1:245385884-245385906 CAAAGTCCTTGGAGATTGGTTGG + Intronic
924697811 1:246418737-246418759 AGAACGACGTGGAGTTTGGCTGG - Intronic
1063288422 10:4714938-4714960 CAGAGGAAATGGAGATTGGATGG - Intergenic
1063488824 10:6444860-6444882 CAAAGGGCTGGGAGAATGGCTGG - Intronic
1064125762 10:12658705-12658727 AGAAGGACGTGGAGTTTGGCTGG + Intronic
1064196465 10:13247691-13247713 CAAAAGAGCTGGAGAATGGCAGG + Intergenic
1064484160 10:15767481-15767503 GAAAGGAGGTGAGGATTGGCAGG - Intergenic
1068081065 10:52317715-52317737 CAAAGTACTTGGTGATTGGCAGG + Intronic
1068196767 10:53727172-53727194 CACAGGATGGGGAGAATGGCGGG + Intergenic
1068610602 10:59056180-59056202 CACAGGAGGAGGAGAGTGGCAGG + Intergenic
1070606016 10:77898992-77899014 CTGAGTACGTGGAGAGTGGCAGG - Intronic
1070637048 10:78137437-78137459 CAAAGGACTTGGAACTTGGCAGG + Intergenic
1070900005 10:80020404-80020426 CAAAGGAGGTGGAGGTTGCAGGG - Intergenic
1071090160 10:81909164-81909186 AGAAGGAGGTGGAGATTGGAGGG - Intronic
1071419069 10:85471373-85471395 AAAAGGTCTTGCAGATTGGCTGG - Intergenic
1074969534 10:118524573-118524595 AAAAGGACGAGGAGATTGTGGGG - Intergenic
1078907180 11:15698508-15698530 CAGAGGAGTTGGAGAATGGCTGG - Intergenic
1079983589 11:27177507-27177529 CAAAGGACGGGGAGATTGACAGG - Intergenic
1084163829 11:67365897-67365919 GGAAGGACGTGCTGATTGGCTGG + Intronic
1086395716 11:86413156-86413178 GGAATGACGTGGAGTTTGGCTGG - Intronic
1092910759 12:13142945-13142967 CAAAGGAAGAGGAGAGAGGCTGG - Intergenic
1095142922 12:38688801-38688823 TAATGGACTTGGAGACTGGCGGG + Intronic
1095376164 12:41531306-41531328 GGAATGACGTGGAGTTTGGCTGG - Intronic
1096025590 12:48358373-48358395 AAAAGGACTTGGAGATTTTCAGG + Intergenic
1101159793 12:101961957-101961979 CAAAGGACGTGGATATGGGGAGG - Intronic
1101239456 12:102823998-102824020 CATGGGACCTGAAGATTGGCAGG + Intergenic
1101644278 12:106614453-106614475 CAAAAGACGTGAAGAAGGGCCGG - Intronic
1102773580 12:115499572-115499594 CAGAGGTGATGGAGATTGGCAGG - Intergenic
1106192786 13:27468577-27468599 CAGAGGCCATGGAGATTGGCAGG + Intergenic
1106533637 13:30618279-30618301 CAAGGAGCGTGGAGATGGGCAGG + Intronic
1106894054 13:34278807-34278829 CAAAGGAAATGTAGTTTGGCTGG - Intergenic
1112616026 13:101006412-101006434 CACAGGAGGTGGAGCTTGGATGG + Intergenic
1117448378 14:55826900-55826922 GAAAGGATTTGGAGACTGGCAGG - Intergenic
1118291548 14:64529331-64529353 AAAAGGAAATGGAGATTGGCGGG - Intronic
1119424974 14:74529133-74529155 CACAGCACGTGGAGGTGGGCAGG + Intronic
1121689243 14:95864100-95864122 CCAGGGAGGTGGAAATTGGCAGG + Intergenic
1121967464 14:98323915-98323937 CAAAGGACATGAATATTGGAAGG + Intergenic
1122368651 14:101214707-101214729 GAAAGTATGTGGAGATGGGCCGG + Intergenic
1126992873 15:54403183-54403205 CAAAGGAGTTGGAGATGGCCAGG - Intronic
1131969911 15:97881608-97881630 CAAAGGCTGTGGAGATGGGGTGG - Intergenic
1139170865 16:64627942-64627964 AGAATGACGTGGAGTTTGGCTGG + Intergenic
1139469389 16:67170272-67170294 GAAAGCACCTGGAAATTGGCAGG + Intronic
1140567573 16:76062092-76062114 CAATGCATGTAGAGATTGGCAGG - Intergenic
1140934386 16:79657039-79657061 CAAAGAGCGTGGCGATTGTCAGG - Intergenic
1148012128 17:44491555-44491577 CAAAGTTGGTGGATATTGGCTGG + Intronic
1152230154 17:79110328-79110350 CAGAGGATGTGGAGAGTGGGAGG - Intronic
1152430399 17:80245686-80245708 GAAAGGACGTGGAGATAGGAAGG + Intronic
1155333647 18:24743129-24743151 CAATTGGAGTGGAGATTGGCTGG + Intergenic
1156261847 18:35451743-35451765 TAAAGGAGGTGGGGAATGGCTGG + Intronic
1159823317 18:73174600-73174622 CAAAGGAAAGGGAGATAGGCTGG - Intronic
1159922771 18:74241013-74241035 CAGAGGACGTGGAGAGAGACAGG - Intergenic
1161809884 19:6465470-6465492 CAAAGCAGGTGCAGATGGGCGGG + Intronic
1163200727 19:15767107-15767129 CAAAGGGAGTGGAGAGTAGCAGG + Intergenic
1163715609 19:18870509-18870531 CCAAGGACGGGGAGCGTGGCCGG + Exonic
1165295845 19:34925446-34925468 AGAAGGACGCGGAGTTTGGCTGG - Intergenic
1165335474 19:35166844-35166866 CAAAGGACATGGATACTGACAGG + Intronic
1167552102 19:50168396-50168418 CAACGGAATTGCAGATTGGCCGG - Intergenic
1168545982 19:57250148-57250170 GAAAGGCTGTGGAGATAGGCTGG - Intronic
925434061 2:3820696-3820718 GGAAGGACGGGGAGATTGGAGGG + Intronic
928420697 2:31136270-31136292 CAAAGTATGTGGAGGTTGGAGGG - Intronic
932791215 2:74655627-74655649 CAAAGTAAGTTGAGATTGCCAGG + Intronic
932885167 2:75542787-75542809 CCAAGAACTTGGAGTTTGGCTGG + Intronic
934679736 2:96274860-96274882 GAAAGGAAGTGGAGGTAGGCGGG + Exonic
937049079 2:118874012-118874034 CACAGGAAGTGGAAAATGGCAGG - Intergenic
937656772 2:124385838-124385860 AAAAGGAAGTGGACATTGGTAGG - Intronic
938745696 2:134276173-134276195 TAAATGAGGTGGAGATTGGCGGG - Intronic
940724887 2:157325877-157325899 CAAAGAAGGTGGTGATTGGCTGG - Intronic
943148224 2:184073740-184073762 GAAAGGACTTGGAGATAGCCAGG - Intergenic
946013878 2:216588414-216588436 AATGGGACGTGGAGACTGGCAGG - Intergenic
947907085 2:233772805-233772827 CAGAGGACGTGCAGACAGGCTGG + Exonic
948900161 2:240952614-240952636 GAGAGGACGTGGACATTGGCAGG + Intronic
1172015975 20:31873137-31873159 GAAAGGACTTGCAGATTGACTGG + Intronic
1172600437 20:36179292-36179314 CAAAGGACAAGCAGATGGGCTGG + Intronic
1179305741 21:40152591-40152613 TAAAGGAAGTGGAGGTTGGGAGG - Intronic
1180794739 22:18597102-18597124 CAAGAGACTTGGAGGTTGGCAGG - Intergenic
1180937046 22:19632742-19632764 GGAATGACGTGGAGTTTGGCCGG - Intergenic
1181227000 22:21398221-21398243 CAAGAGACTTGGAGGTTGGCAGG + Intergenic
1181251649 22:21536622-21536644 CAAGAGACTTGGAGGTTGGCAGG - Intergenic
949503893 3:4708372-4708394 CAAAGGAAGTTGAGTGTGGCTGG + Intronic
952406766 3:33012261-33012283 CAGAGGCCTTGGAGAATGGCTGG - Intronic
954135525 3:48580462-48580484 CAAAGGAAGTGAAGATTGGGAGG + Intronic
954411029 3:50371172-50371194 CTAAGGGCGTGGAGACGGGCTGG + Intronic
960992458 3:123320873-123320895 CAAAGGACGTGGACATAGAGAGG + Intronic
963645538 3:147909238-147909260 GAAAGGCCGTGGAGATGGTCAGG + Intergenic
966285791 3:178293840-178293862 AGAAGGACGTGGAGTGTGGCTGG - Intergenic
970752819 4:19385241-19385263 CAAAGGACAGGGAGAATGGTGGG + Intergenic
972397663 4:38671793-38671815 CGAAGGTGGTGGTGATTGGCAGG + Intronic
974137995 4:57843972-57843994 CAAAGCACGTGGAAAGAGGCAGG - Intergenic
975979388 4:80139311-80139333 CAAAGGACCAGGAGACTGGGAGG - Intergenic
977679241 4:99780677-99780699 CAAAAGCAGTTGAGATTGGCTGG + Intergenic
978567616 4:110100776-110100798 CAAAGGACGGGGAGATGGAGTGG + Intronic
980734450 4:136867189-136867211 CAAAGGATGGGGAGTATGGCAGG - Intergenic
982315093 4:154023912-154023934 AGAACGACGTGGAGTTTGGCCGG + Intergenic
985577416 5:679865-679887 CAAAGCACGTGCTGATGGGCTGG - Intronic
985592348 5:771961-771983 CAAAGCACGTGCTGATGGGCTGG - Intergenic
987372021 5:17202235-17202257 AAAAGCTCGTGGAGTTTGGCGGG + Intronic
992270074 5:75054385-75054407 GAAAGGACGTGGAGCCTCGCGGG - Intergenic
992479270 5:77134441-77134463 CAAATGAGGTGCAGCTTGGCAGG + Intergenic
995556108 5:113330699-113330721 CAAAGGAAGTGGTAATTGCCAGG + Intronic
995979004 5:118078774-118078796 GGAAGGCCGTGGAGTTTGGCCGG + Intergenic
996472137 5:123872913-123872935 CAAAGGCCTTGAAGATTGGGAGG + Intergenic
998622759 5:143812601-143812623 CAAGGGAAGTGCAGATGGGCAGG + Intronic
998891775 5:146753881-146753903 CAAAGGACTTGGAGGTTTTCAGG - Intronic
1003094457 6:3131622-3131644 CAAAGTCCGTGCAGTTTGGCTGG + Intronic
1003847250 6:10185920-10185942 CAAAGGATGGGGAGATGGGCAGG - Intronic
1003923146 6:10852650-10852672 CAAAGGACCTGGAAATTGAGGGG - Intronic
1005331795 6:24757864-24757886 CAAAGGAAGTGGAGATGGCTGGG + Intergenic
1005712200 6:28513074-28513096 GGAAGGACATGGAGTTTGGCCGG + Intronic
1006244230 6:32716287-32716309 CAAAGGGCGTGGATATAGGGAGG - Intergenic
1007252570 6:40505879-40505901 CAAGGCACGTGGAGATGGGCAGG + Intronic
1007317505 6:41001002-41001024 CCAAGGGGGTGGAAATTGGCTGG + Intergenic
1007502117 6:42306296-42306318 AAAAGAAGGGGGAGATTGGCCGG - Intronic
1007633804 6:43286380-43286402 CAAAGCAGGTGGAGACTGGCTGG + Exonic
1008385547 6:50885890-50885912 CAAAGGACATGGACATTGTCTGG + Intergenic
1012673362 6:102085280-102085302 CATAGGAAGAGGAGATTGGGTGG - Intergenic
1014323785 6:119966298-119966320 GGAAGAACGTGGAGTTTGGCTGG + Intergenic
1015456335 6:133430996-133431018 CACAGGACATGAAGAATGGCTGG + Intronic
1020825032 7:13016477-13016499 GGAAGGACATGGAGTTTGGCTGG + Intergenic
1021027729 7:15688594-15688616 CCAAGGGCGTGGGGAGTGGCAGG - Intergenic
1022851568 7:34268249-34268271 CAATGGAAGTGGGGACTGGCTGG + Intergenic
1022877032 7:34544781-34544803 GGAATGACGTGGAGTTTGGCTGG + Intergenic
1029570383 7:101364429-101364451 CAAAAGAAATGGAGATTGGGAGG - Intronic
1030656346 7:112172478-112172500 CAAAGGAAGTGGAAATTACCTGG - Intronic
1031232298 7:119123580-119123602 CAGATGACGTGGAATTTGGCTGG + Intergenic
1032657034 7:133941751-133941773 CAAAGGACTTCAAGAGTGGCTGG + Intronic
1034054081 7:148016169-148016191 CAAAGGACGTGGAGATTGGCAGG - Intronic
1035118865 7:156548297-156548319 CAAAGGCCGTGGGGATCAGCAGG - Intergenic
1035245748 7:157561160-157561182 CAGAGGGCGGGGAGACTGGCCGG - Intronic
1035548268 8:500474-500496 TACAGGAGGTGAAGATTGGCAGG - Intronic
1038356275 8:26832064-26832086 GAAAGGAAGGGGAGATTGGGAGG - Intronic
1041312337 8:56529689-56529711 AGAAGGACATGGAGTTTGGCTGG + Intergenic
1049409790 8:142467434-142467456 GAAAGGATGTGGACATGGGCAGG + Intronic
1056588095 9:87941462-87941484 GAAAGGGTGTGGACATTGGCTGG + Intergenic
1056608771 9:88111483-88111505 GAAAGGGTGTGGACATTGGCTGG - Intergenic
1058882146 9:109294894-109294916 CAAAGGAGTTGGGGATTGGAGGG + Intronic
1059717041 9:116922929-116922951 CACAGGACATGAAGATTGGAAGG + Intronic
1185756278 X:2655494-2655516 CAGAGGAGGGGGAGACTGGCTGG + Intergenic
1188527615 X:31103320-31103342 TAAAGGACCTTGACATTGGCTGG - Intronic
1188536378 X:31201401-31201423 CAAAGAGCTTGGAGACTGGCTGG + Intronic
1189104820 X:38224386-38224408 CAAAGGACATGAAGATAGGAGGG + Intronic
1191940100 X:66469522-66469544 CAAAGGATGTTGAGATGGGTGGG + Intergenic
1193275474 X:79582177-79582199 CAAAGAACATGGAAATTGTCTGG - Intergenic
1194979770 X:100428413-100428435 CAACAGAGGTGGAGATTGGAGGG - Intergenic
1196960484 X:120994753-120994775 CAAAGGACCAGGAAAATGGCAGG - Intergenic
1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG + Intergenic
1198518489 X:137430156-137430178 CAAATGACGTAGAGAGTGCCAGG - Intergenic