ID: 1034056913

View in Genome Browser
Species Human (GRCh38)
Location 7:148044986-148045008
Sequence TAAGCTAGACACAGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034056913_1034056919 22 Left 1034056913 7:148044986-148045008 CCAGCCACCCTGTGTCTAGCTTA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1034056919 7:148045031-148045053 CTGTGAAAGCTCTGAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034056913 Original CRISPR TAAGCTAGACACAGGGTGGC TGG (reversed) Intronic
900523153 1:3115911-3115933 GATGCTGGACACAGGGTGGGAGG - Intronic
901782305 1:11602136-11602158 TGGGCTAGACACTGGGTGGAAGG + Intergenic
904317276 1:29673656-29673678 GGAGCTGGACACAGAGTGGCTGG - Intergenic
907352515 1:53844463-53844485 TAAGTTAATCACAGGCTGGCAGG - Intergenic
907757478 1:57324887-57324909 GGAGCTACACACAGAGTGGCTGG - Intronic
912213472 1:107580531-107580553 AGAGCTATACACTGGGTGGCAGG - Intronic
912840040 1:113031257-113031279 TAGGCTGGACACAGTGTGGAGGG - Intergenic
913241513 1:116834254-116834276 TAATCTAACCACAGGGCGGCTGG + Intergenic
914421026 1:147528459-147528481 TAAGCTAGAGAAAAGGTGGAGGG - Intergenic
915308320 1:154993697-154993719 TAAGATGGGCACAGGGTGGGAGG + Exonic
916572289 1:166038452-166038474 TAATCTGGACACAGGGAGGCAGG + Intergenic
917020924 1:170585917-170585939 TAAGGTTGACACATGGAGGCAGG + Intergenic
918588037 1:186210338-186210360 TACAATAGACACAGGGAGGCAGG - Intergenic
920673534 1:208023247-208023269 CATGCAAGACACAGCGTGGCTGG + Exonic
920689813 1:208137350-208137372 AAATCTATACACAGGGTGGATGG - Intronic
1063815351 10:9765597-9765619 TAGGCTAGTCACAGTGGGGCAGG + Intergenic
1067783135 10:49223451-49223473 GAGGCTGGAGACAGGGTGGCTGG + Intergenic
1068919413 10:62466427-62466449 CAAGCCAGGCACAGAGTGGCAGG - Intronic
1072005211 10:91239096-91239118 TAAGATAGAGACAGGGTGCTGGG - Intronic
1078859771 11:15236279-15236301 TAAGGTAGTCTCAGGGTGGGGGG + Intronic
1079394514 11:20050268-20050290 CAAGCTACACAGTGGGTGGCAGG - Intronic
1088907868 11:114168636-114168658 AAAGCAAGACACAGGGTGGAAGG - Intronic
1090296618 11:125593368-125593390 GAAACTAGAGGCAGGGTGGCAGG + Intronic
1091871323 12:3893581-3893603 AAAGCGAGACACAGAGTGACTGG - Intergenic
1093048794 12:14484082-14484104 TCAGCTAGCTACCGGGTGGCAGG - Intronic
1095273951 12:40256800-40256822 TATGCTAGACACTGGTGGGCTGG - Intronic
1095514628 12:42992438-42992460 TAAGATAGTCCCAGGTTGGCTGG + Intergenic
1099654850 12:85477019-85477041 TATGCTATATACAGGGTGGCTGG + Intergenic
1100447777 12:94677145-94677167 AAAGCTAGACAGTGGCTGGCCGG - Intergenic
1103801176 12:123538497-123538519 TAAGTTAAAGACAGGGAGGCAGG + Intergenic
1105608313 13:21945575-21945597 TAACCTCTTCACAGGGTGGCAGG + Intergenic
1107235127 13:38159239-38159261 TAAGGTAGAAACAGGGTAGCAGG + Intergenic
1112108606 13:96269472-96269494 TAACCTAGAGACAAGGTGGGGGG + Intronic
1113350731 13:109526657-109526679 AAAGGTAGACACAGTGTGGGTGG - Intergenic
1115039151 14:28899776-28899798 TAACCTAAAATCAGGGTGGCAGG - Intergenic
1118898227 14:69964709-69964731 TAACCTATACACAAGGTGCCAGG + Intronic
1119660349 14:76446953-76446975 TGAGAGAGACACAGGGTGACAGG - Intronic
1121763001 14:96461479-96461501 AAGGCTAGAAACAGGGTGCCAGG + Intronic
1123045185 14:105508879-105508901 CAAGCGGCACACAGGGTGGCAGG - Intergenic
1124882209 15:33652968-33652990 TCAGCTTGACACACTGTGGCAGG - Intronic
1125610142 15:40964151-40964173 TATGCCAGGCAGAGGGTGGCAGG + Intergenic
1127387907 15:58482202-58482224 TAGGCTGGAAACTGGGTGGCTGG - Intronic
1127688095 15:61368144-61368166 TCAGCTAGCCACCTGGTGGCAGG + Intergenic
1128705365 15:69834237-69834259 TGAGCTAGACTCGGGCTGGCTGG - Intergenic
1129169326 15:73798178-73798200 TAAGGTAGACACAGGGTCCTGGG + Intergenic
1130062444 15:80579608-80579630 TGAGCTAGTCCCAGGGAGGCAGG + Intronic
1130170682 15:81509818-81509840 CAAGTTAGACAGAGGGTGGGAGG - Intergenic
1130890633 15:88130956-88130978 GAAGCTGGACAAAGGGTGGAAGG + Intronic
1133230966 16:4366313-4366335 TGAGCTGGACATAGAGTGGCAGG - Intronic
1135514023 16:23114244-23114266 TAAGCCAGAGACAGGAAGGCAGG + Intronic
1136071547 16:27790715-27790737 CAGGCTGGACACAGGCTGGCAGG - Exonic
1137440956 16:48498194-48498216 GAAGCCAGACACAGAGTGGTTGG + Intergenic
1137573823 16:49585094-49585116 TAATTTAGAAAGAGGGTGGCTGG - Intronic
1137600084 16:49750492-49750514 TCAGCCAGACACAGGGAGGAGGG + Intronic
1139237525 16:65355651-65355673 GAAGCTAGACACAGGGTAGACGG + Intergenic
1142013418 16:87729540-87729562 AAAGCAAGACACAGGGGAGCTGG - Intronic
1142234627 16:88915788-88915810 TGGGCTAGACACAGGGTGGGCGG + Intronic
1142732607 17:1871437-1871459 GAAGGCAGAGACAGGGTGGCAGG + Intronic
1143978711 17:10849422-10849444 TGTGCTAGAGACAGGGAGGCAGG - Intergenic
1149000950 17:51756882-51756904 TGGTCTAGACCCAGGGTGGCAGG + Intronic
1149177682 17:53893829-53893851 TAAGGTAGGCACAAAGTGGCAGG + Intergenic
1152099513 17:78292778-78292800 GAAGCTGGACACAGAGAGGCAGG - Intergenic
1152778015 17:82214045-82214067 GGAGCTGGACACAGGGTGGGGGG - Intergenic
1154047046 18:10916042-10916064 TTAGCTAGACACAGAGTGCTTGG + Intronic
1162604629 19:11697252-11697274 TGAGGTAGACACGGCGTGGCGGG + Intergenic
1162971653 19:14184271-14184293 TAAGCTGGAGACAGGCAGGCGGG + Intronic
1164124025 19:22293788-22293810 AAAGGTAGACAAAAGGTGGCTGG - Intronic
1167369269 19:49071216-49071238 AAAGCTAGGCACAAGGTGGTGGG - Intronic
1168189203 19:54725775-54725797 CAAGGTAGACACAGGATGGAGGG - Intronic
933652168 2:84858319-84858341 TCTGCTGGCCACAGGGTGGCAGG - Intronic
934067039 2:88350345-88350367 CAAGCCAGACTCAGGCTGGCAGG + Intergenic
934872700 2:97881665-97881687 TGAGCTAGGGACAGGGTGCCAGG + Intronic
935099502 2:99979506-99979528 TAAGTTAGAAACAGGCAGGCTGG + Intronic
936111585 2:109670104-109670126 TAAGCCAGGCACAGAGTAGCTGG + Intergenic
940030929 2:149260487-149260509 TAAGCTAGAGTCAGGAAGGCTGG - Intergenic
944064488 2:195604337-195604359 TAAGCAAGGCACAGGGGGTCTGG + Intronic
944193755 2:197030416-197030438 GAAGCAAGACACAGGGATGCAGG + Intronic
945491311 2:210458534-210458556 GGAGCGAGACACAGGGTGGGTGG + Intronic
947952720 2:234161896-234161918 TCAGCTTGAGACAGGGTGCCAGG + Intergenic
1168889531 20:1285798-1285820 TGAGATAGATAAAGGGTGGCCGG + Intronic
1171402087 20:24880247-24880269 TAAGTTAAACACAGGTTGTCTGG + Intergenic
1172943964 20:38674050-38674072 AAAGCTGGACCCAGGGTAGCGGG + Intergenic
1175639985 20:60620881-60620903 CAAGCTGCACACAGGCTGGCAGG + Intergenic
1176659515 21:9621311-9621333 TAAGCCAGGCAGAGTGTGGCAGG + Intergenic
1181324299 22:22032871-22032893 TAAGACAGACACAGGGTGAGAGG - Intergenic
1182371896 22:29817081-29817103 TAAGCAAGTCACTAGGTGGCTGG + Intronic
1182965851 22:34520287-34520309 TAAGCTAGCTACTTGGTGGCAGG + Intergenic
1184819456 22:46898609-46898631 TAACCTAGACACAATGGGGCAGG + Intronic
957649366 3:82980049-82980071 TAAGCAAAACACAGCGTGGTAGG + Intergenic
963215921 3:142747524-142747546 TGAGCCACAAACAGGGTGGCTGG - Intronic
965426777 3:168534943-168534965 TTATCTAGCCACAGTGTGGCTGG + Intergenic
966690059 3:182732562-182732584 TAAGGGAGAGACAGGTTGGCAGG - Intergenic
967926521 3:194653216-194653238 TAAGATGGACAGAGGATGGCTGG + Intronic
968589099 4:1448905-1448927 CAAGCTAGACAAAGGAGGGCTGG + Intergenic
968669926 4:1843753-1843775 GAACCTAGAGACATGGTGGCTGG - Intronic
969217619 4:5734850-5734872 AAAGCTGGACACAGGCTGCCTGG - Intronic
971154789 4:24069908-24069930 TAAACTAGAGACAGGATGCCTGG + Intergenic
971253418 4:24992324-24992346 TAAGCTCCAGAGAGGGTGGCTGG + Intergenic
974975794 4:68889405-68889427 TAGGCTATTCACAGGTTGGCTGG + Intergenic
982044103 4:151424508-151424530 TAAGGTAGACTCAGAGTGGATGG + Intronic
982279453 4:153668406-153668428 TAAGCTTGAGACAGTGTTGCAGG + Intergenic
982857870 4:160408064-160408086 TATGATAGACGCATGGTGGCAGG - Intergenic
984713201 4:182903209-182903231 TAAGAAAGACACTGGCTGGCAGG + Intronic
985415857 4:189735102-189735124 TAAGCCAGGCAGAGTGTGGCAGG - Intergenic
987308550 5:16661022-16661044 TAGGATAGACACATGGTGGGAGG + Intergenic
989541108 5:42619725-42619747 GAAACGAGACACAGAGTGGCAGG + Intronic
991697783 5:69289077-69289099 CAAGCTCCACACAGGGTTGCAGG + Intronic
992499295 5:77325985-77326007 TGAGCAATACACAGGGTGGGGGG - Intronic
999431823 5:151531400-151531422 TAAGCTGGCCCCAGGGTGGAAGG + Intronic
1010325186 6:74555611-74555633 TCAGCCAGCCACATGGTGGCAGG - Intergenic
1010672691 6:78705285-78705307 TAAGCCAGACACACGGTAGTAGG + Intergenic
1016356371 6:143223127-143223149 TCTGCTAGACAGAGGCTGGCTGG - Intronic
1018445278 6:163852723-163852745 GCAGCTAGAAACAAGGTGGCAGG - Intergenic
1021112634 7:16713109-16713131 TGAGTCAGACACAGGCTGGCAGG - Intergenic
1022234774 7:28450686-28450708 GAAGAGAAACACAGGGTGGCAGG + Intronic
1023764868 7:43501257-43501279 GAAGCTATACCCAGGGTGGAAGG - Exonic
1029099801 7:98119690-98119712 GCAGCTAGAGTCAGGGTGGCAGG + Intronic
1031252354 7:119402311-119402333 TAACCAAGACACAGGGTAGCTGG + Intergenic
1033124841 7:138698424-138698446 TAGACTAGAGGCAGGGTGGCTGG + Intronic
1034056913 7:148044986-148045008 TAAGCTAGACACAGGGTGGCTGG - Intronic
1036377143 8:8210302-8210324 CAAGCTACACACAGGCTGCCTGG - Intergenic
1045168131 8:99630200-99630222 AAAGCAAGACTCTGGGTGGCAGG - Intronic
1045349515 8:101325340-101325362 TAAGATAGATGCAGGGTGGTTGG - Intergenic
1047606735 8:126482000-126482022 TAAGTAGGACACAGGGAGGCCGG + Intergenic
1047802013 8:128319589-128319611 TGAGCTGGGCACAGAGTGGCAGG - Intergenic
1048351596 8:133620964-133620986 GATGCTAGACCCAGGGTGGGAGG - Intergenic
1048977743 8:139682399-139682421 TGAGCACGACACAGGGTGGCAGG + Intronic
1049759072 8:144323760-144323782 GAACCTGGAGACAGGGTGGCGGG - Intronic
1052432494 9:28385061-28385083 TAAGCTAGACACTGGGGTACAGG + Intronic
1053299464 9:36938726-36938748 TGAGCTTGACAGAGGGTGGCAGG - Intronic
1053430308 9:38037875-38037897 TAGGCATGACACAAGGTGGCTGG + Intronic
1055558778 9:77502261-77502283 TATGCCAGTCACAAGGTGGCAGG - Intronic
1057305691 9:93910821-93910843 CAGGCTGGCCACAGGGTGGCAGG + Intergenic
1057719479 9:97520437-97520459 TAGGGAAGACACAGGGTGGGAGG - Intronic
1203637076 Un_KI270750v1:123154-123176 TAAGCCAGGCAGAGTGTGGCAGG + Intergenic
1185566568 X:1099601-1099623 TCAGCTGGACAGAAGGTGGCTGG + Intergenic
1187997510 X:24944385-24944407 TAAGTTAGACAGGGGGTGGGGGG - Intronic
1191909482 X:66133031-66133053 TAAGCTAGGCACAGGAAGACAGG - Intergenic
1192297575 X:69867041-69867063 TCAGCTAGCCACCTGGTGGCAGG - Intronic
1195498397 X:105564988-105565010 TAAGAGAGACCCAGGGTGGGAGG + Intronic
1196402900 X:115334477-115334499 TATGCTAAAGACATGGTGGCAGG + Intergenic
1199783283 X:151082528-151082550 TAGGCTGACCACAGGGTGGCGGG - Intergenic
1201593397 Y:15639339-15639361 TAAGAGGGACACAGGGTGGGAGG - Intergenic