ID: 1034059854 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:148077015-148077037 |
| Sequence | CCATATATACAGGCGGGGCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1034059847_1034059854 | 21 | Left | 1034059847 | 7:148076971-148076993 | CCACAATGTTGGATTTCCTTCAA | 0: 1 1: 0 2: 1 3: 13 4: 212 |
||
| Right | 1034059854 | 7:148077015-148077037 | CCATATATACAGGCGGGGCATGG | No data | ||||
| 1034059848_1034059854 | 5 | Left | 1034059848 | 7:148076987-148077009 | CCTTCAAGCTTGAGAAATATTAA | 0: 1 1: 0 2: 0 3: 30 4: 258 |
||
| Right | 1034059854 | 7:148077015-148077037 | CCATATATACAGGCGGGGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1034059854 | Original CRISPR | CCATATATACAGGCGGGGCA TGG | Intronic | ||
| No off target data available for this crispr | |||||