ID: 1034059854

View in Genome Browser
Species Human (GRCh38)
Location 7:148077015-148077037
Sequence CCATATATACAGGCGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034059847_1034059854 21 Left 1034059847 7:148076971-148076993 CCACAATGTTGGATTTCCTTCAA 0: 1
1: 0
2: 1
3: 13
4: 212
Right 1034059854 7:148077015-148077037 CCATATATACAGGCGGGGCATGG No data
1034059848_1034059854 5 Left 1034059848 7:148076987-148077009 CCTTCAAGCTTGAGAAATATTAA 0: 1
1: 0
2: 0
3: 30
4: 258
Right 1034059854 7:148077015-148077037 CCATATATACAGGCGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034059854 Original CRISPR CCATATATACAGGCGGGGCA TGG Intronic
No off target data available for this crispr