ID: 1034060833

View in Genome Browser
Species Human (GRCh38)
Location 7:148087096-148087118
Sequence TAGTTCGGGCACGTGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034060833_1034060838 24 Left 1034060833 7:148087096-148087118 CCTCAGAACACGTGCCCGAACTA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1034060838 7:148087143-148087165 TCTTTCTACAGCGTGGTCACTGG 0: 1
1: 0
2: 0
3: 5
4: 79
1034060833_1034060837 17 Left 1034060833 7:148087096-148087118 CCTCAGAACACGTGCCCGAACTA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1034060837 7:148087136-148087158 ATTGATTTCTTTCTACAGCGTGG 0: 1
1: 0
2: 0
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034060833 Original CRISPR TAGTTCGGGCACGTGTTCTG AGG (reversed) Intronic
910182074 1:84495898-84495920 TATTTCAGGTATGTGTTCTGTGG - Exonic
912620443 1:111151076-111151098 TACCTTGGGCACGTGTTCTCAGG - Intronic
919347331 1:196400963-196400985 TTGTTCTGGCAGGTTTTCTGTGG - Intronic
1065819081 10:29508712-29508734 AATTTCGGGCACTTGTTCTGGGG + Intronic
1076795305 10:132795288-132795310 TAGTCTGGGCACGTGCCCTGAGG + Intergenic
1078536367 11:12178361-12178383 TACTTTGGGCACATGTTCTCAGG - Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1086146311 11:83556091-83556113 TATTTATGGCACGTGTTTTGAGG + Intronic
1111772825 13:92621462-92621484 AAGTTCAGTCACGTTTTCTGTGG - Intronic
1113254707 13:108495088-108495110 TTGTTCTGGCACATGTTCTCTGG + Intergenic
1120491253 14:85181044-85181066 CAGTTCTGGCAAGTCTTCTGGGG - Intergenic
1120871405 14:89340203-89340225 TGGTTGGGGCGTGTGTTCTGAGG + Intronic
1120911720 14:89672838-89672860 TAGCACAGGCAAGTGTTCTGGGG - Intergenic
1126550560 15:49924244-49924266 AAGTTAGGCCAAGTGTTCTGTGG - Intronic
1127972731 15:63974318-63974340 TACCTTGGGCACATGTTCTGAGG - Intronic
1132191705 15:99867795-99867817 AAGTTCAGTCACGTTTTCTGTGG + Intergenic
1135204765 16:20474133-20474155 CAATTTGGGCACGTGTTCTCAGG + Intronic
1141206508 16:81937113-81937135 TAGCTCAGGCACGTCTTCAGTGG - Intronic
1146642936 17:34554945-34554967 TTGTTCGGGCACATGTGTTGGGG - Intergenic
1154048494 18:10930542-10930564 CAGTTTGGGCACATGTTCTCAGG + Intronic
1156185733 18:34660932-34660954 TACTTTGGGCACATGTTCTCAGG + Intronic
1157197325 18:45630052-45630074 TAGTACTGGGATGTGTTCTGTGG - Intronic
1158569207 18:58582653-58582675 TACCTCGGGCACTTGTTCTCAGG - Intronic
1161052790 19:2173657-2173679 TACAGCGGGCACGGGTTCTGCGG + Intronic
1167985411 19:53310277-53310299 TGGTTCTGACACGTGTACTGCGG - Intergenic
928456983 2:31431166-31431188 TAGTTCTGGGACACGTTCTGGGG + Intergenic
933691458 2:85182211-85182233 GAGGTCTGGCACGTGATCTGGGG + Intronic
934830275 2:97514033-97514055 CACTTCGGGCACATGTTCTCAGG + Intronic
1174956212 20:55101685-55101707 TACTTTGGGCACATGTTCTTAGG - Intergenic
1176380273 21:6109127-6109149 GAGTTTGGGGACCTGTTCTGCGG + Intergenic
1179620030 21:42608071-42608093 TACCTTGGGCACGTGTTCTCAGG - Intergenic
1179743201 21:43429111-43429133 GAGTTTGGGGACCTGTTCTGCGG - Intergenic
1184724303 22:46334693-46334715 CAGTTTGAGCACGTGTTCTCAGG - Intronic
949476593 3:4452580-4452602 TAGTTATAGCACATGTTCTGAGG + Intronic
950373910 3:12554548-12554570 TGGATCGGGCACATGTTCTCAGG - Intronic
950872657 3:16243028-16243050 TAGTTCTGGAACATGTTCTGTGG - Intergenic
952845556 3:37685190-37685212 TTGTTCAGGCACATATTCTGTGG + Intronic
954405666 3:50343741-50343763 TAGATGGGGAAGGTGTTCTGGGG + Exonic
956543006 3:70364594-70364616 TGGTTCTGGCTAGTGTTCTGTGG + Intergenic
965139423 3:164815475-164815497 AAGTTGGGACATGTGTTCTGTGG - Intergenic
968965448 4:3766958-3766980 TACTTCGGGCAGGTGTGGTGCGG + Exonic
986893044 5:12332348-12332370 CACTTTGGGCACGTGTTCTCAGG - Intergenic
1001777617 5:174340578-174340600 TAACTCGGGCACTTCTTCTGAGG + Intergenic
1019099703 6:169619470-169619492 CACTTTGGGCACATGTTCTGAGG - Intronic
1028868559 7:95739962-95739984 TAGATCTGGCAGGTGTTCTCTGG - Intergenic
1034060833 7:148087096-148087118 TAGTTCGGGCACGTGTTCTGAGG - Intronic
1036295239 8:7529402-7529424 TACCTTGGGCACATGTTCTGAGG - Intergenic
1036327331 8:7791616-7791638 TACCTTGGGCACATGTTCTGAGG + Intergenic
1039799339 8:40940750-40940772 TACCTTGGGCACGTGTTCTCAGG - Intergenic
1044320155 8:90792086-90792108 TAGTTCTCGCCTGTGTTCTGGGG - Intronic
1044723912 8:95176680-95176702 TACCTCGGGCACATGTTCTCAGG + Intergenic
1048383287 8:133887755-133887777 TAGTTTGAGAACATGTTCTGAGG - Intergenic
1058531861 9:105913920-105913942 TACCTTGGGCACGTGTTCTCAGG + Intergenic
1060523792 9:124309185-124309207 TAGATGGAGCACGTGTGCTGGGG - Intronic
1186718260 X:12276306-12276328 TACCTCGGGCACATGTTCTCAGG - Intronic
1190004903 X:46726438-46726460 CAGTTCTGGCACATGGTCTGGGG - Intronic
1202050311 Y:20774044-20774066 CACTTTGGGCACGTGTTCTCAGG + Intronic