ID: 1034064987

View in Genome Browser
Species Human (GRCh38)
Location 7:148127504-148127526
Sequence CCGCTGCCTGCACATTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034064987_1034064992 13 Left 1034064987 7:148127504-148127526 CCACAAAAATGTGCAGGCAGCGG 0: 1
1: 0
2: 1
3: 14
4: 202
Right 1034064992 7:148127540-148127562 TAATCTTAGGAAATAATATGAGG 0: 1
1: 0
2: 1
3: 30
4: 315
1034064987_1034064990 0 Left 1034064987 7:148127504-148127526 CCACAAAAATGTGCAGGCAGCGG 0: 1
1: 0
2: 1
3: 14
4: 202
Right 1034064990 7:148127527-148127549 CCTAATGTCCTACTAATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034064987 Original CRISPR CCGCTGCCTGCACATTTTTG TGG (reversed) Intronic
900828185 1:4943404-4943426 CCGCTGGCTGCTGATTTCTGTGG + Intergenic
904300809 1:29552208-29552230 CTGCTGCCTGCACATTCTAGGGG - Intergenic
904457391 1:30655836-30655858 CTGCTGCCTGCACATTCTAGGGG + Intergenic
913518185 1:119622763-119622785 CCGCAGCCCGCACACTTGTGCGG + Exonic
920661606 1:207920306-207920328 CCCATGCCAGGACATTTTTGGGG + Intergenic
921083947 1:211769603-211769625 CTGCTGGCTGCCCATTTTTATGG + Intronic
922546522 1:226461906-226461928 CTGCAACCTGCACATTTTGGAGG - Intergenic
923066317 1:230520448-230520470 CCTCAGCCTCCAAATTTTTGAGG + Intergenic
923089380 1:230727975-230727997 CCCCTGCCTTCATATTTTTGAGG - Intergenic
1066298191 10:34074590-34074612 CCGCTGTCTGTACATTGTTGTGG + Intergenic
1071190687 10:83096055-83096077 CGGCTGCCTGATCATTTTTCTGG + Intergenic
1071248574 10:83791540-83791562 CCGCTGCCTGAGCATTTCAGTGG - Intergenic
1075214340 10:120519107-120519129 CCACTGACTGCACTTTCTTGTGG + Intronic
1076130271 10:128009147-128009169 CAGCAGCCTGCACATTCTGGAGG + Intronic
1076802103 10:132835604-132835626 CCGCTGCCTGCGCAATGATGTGG - Intronic
1077184587 11:1230484-1230506 CTGCTGTCGGCACATTTCTGGGG - Exonic
1077386137 11:2270372-2270394 CCTCTGCCTGCACCTTCCTGCGG - Exonic
1079460118 11:20671039-20671061 CCGCTGCCTGCTCAGTCCTGGGG - Intronic
1079717932 11:23771565-23771587 CTGCTGGTTGCACATTTTTATGG + Intergenic
1083686371 11:64378505-64378527 CCGCTGCATGCACGTTTTAAAGG + Intergenic
1084153605 11:67302428-67302450 CCCCTGCCTGCTCATTCCTGGGG - Exonic
1085349157 11:75787500-75787522 CTGCTTCCTGCACATTATGGTGG - Intronic
1085590202 11:77753072-77753094 CTGCTGCTTGCCCATTTTTATGG - Intronic
1085974318 11:81634543-81634565 CTGCTGCTTGCCCATTTTTTTGG - Intergenic
1086081649 11:82909138-82909160 CTGCTGGCTGCCCATTTTTATGG + Intronic
1087119483 11:94558730-94558752 CTGCTGGTTGCCCATTTTTGTGG - Intronic
1087152128 11:94868575-94868597 ATGCTACCTGCACATTTCTGCGG - Intronic
1087991402 11:104748279-104748301 CTGCTGGTTGCACATTTTTATGG - Intergenic
1089347697 11:117801405-117801427 TCTCTGCCTGCACACATTTGTGG - Intronic
1092853392 12:12650959-12650981 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
1094020473 12:25908379-25908401 CAGCTGCCTGTGCATTTATGAGG - Intergenic
1098694342 12:73533502-73533524 CCGCTGCCAGAACATCTTTTCGG - Intergenic
1100829855 12:98507992-98508014 CTGCTGATTGCCCATTTTTGTGG + Intergenic
1101175922 12:102151526-102151548 CTGATGCCTGCACACTTTTTAGG + Intronic
1101809312 12:108093765-108093787 CCCCTGCCTGCACCTGTTTGGGG + Intergenic
1102094963 12:110231437-110231459 CAGCTGTCTGCACATTTATATGG + Intergenic
1102333196 12:112053500-112053522 CTGCTGACTGCACACTATTGAGG - Intronic
1104271112 12:127283036-127283058 CAGCTGCCTGCACTTTTTCAAGG - Intergenic
1104464392 12:128978759-128978781 CCGCTGTTTGCCCATTTTTATGG + Intronic
1105053851 12:133079796-133079818 CTGCTGGTTGCGCATTTTTGTGG - Intergenic
1105779368 13:23693545-23693567 CTGCTGCTTGCCCATTTTTATGG + Intergenic
1109704655 13:66074055-66074077 CTGCTGCTTGCCCATTTTTATGG + Intergenic
1109897988 13:68719460-68719482 CTGCTGACTGCCCATTTTTATGG - Intergenic
1113089831 13:106605484-106605506 CTGCTGCTTGCCCATTTTTATGG - Intergenic
1114441939 14:22755631-22755653 CCTCTGTCTGCACATGTTTCTGG - Intergenic
1115428755 14:33291625-33291647 CCGCTGGCTTTATATTTTTGAGG + Intronic
1116993727 14:51301662-51301684 CCTCTACCTGAACATTTTTTAGG - Intergenic
1119034680 14:71219530-71219552 CTGCTGGCTGCCCATTTTTATGG + Intergenic
1119085872 14:71738430-71738452 CCGGTGCCTGCATGTGTTTGGGG + Intronic
1120865876 14:89294810-89294832 CTGCTGGCTGCCCATTTTTATGG - Intronic
1121681005 14:95792679-95792701 TCGCTGCCTGCACAGTCTTCAGG - Intergenic
1124029646 15:25998668-25998690 CGGCTGCCTGCACGTTTTCCTGG + Intergenic
1124032660 15:26025765-26025787 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
1126208725 15:46075787-46075809 CTGCTGCCTGCTAATCTTTGTGG + Intergenic
1128328671 15:66741662-66741684 CCTCTGAGTGTACATTTTTGGGG + Intronic
1128940037 15:71780612-71780634 CCGCTGCCTGCAAGCTGTTGGGG + Exonic
1130288022 15:82571667-82571689 CCGCTGCCTCTGCACTTTTGGGG + Exonic
1133569215 16:7025154-7025176 CTGCTGCCTGCCCATTTTTATGG + Intronic
1133942962 16:10325723-10325745 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
1134471128 16:14526828-14526850 CTGCAGCCAGCCCATTTTTGTGG + Intronic
1134491993 16:14702618-14702640 CCGCAGCATGCACCTTTTTAAGG + Intergenic
1134497374 16:14741740-14741762 CCGCAGCATGCACCTTTTTAAGG + Intronic
1135120320 16:19760837-19760859 CTGCTGGCTGCCCATTTTTATGG + Intronic
1139066553 16:63322722-63322744 CTGCTGGTTGCACATTTTTATGG - Intergenic
1139289513 16:65844751-65844773 CATCTGACTGCACATATTTGGGG + Intergenic
1140438713 16:74969900-74969922 CCTCAGCCTGCTAATTTTTGTGG + Intronic
1141403396 16:83770598-83770620 CTGCTGGTTGCCCATTTTTGAGG + Intronic
1141997831 16:87646417-87646439 TCCCTGCCTGAACATTTCTGAGG - Intronic
1144010933 17:11147801-11147823 CCACTGCCTGCACATTCCTTTGG - Intergenic
1147212979 17:38882880-38882902 TCTCTGACTGCACATATTTGGGG + Intronic
1150844264 17:68639094-68639116 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
1151401675 17:73859765-73859787 CCGCTGGTTGCCCATTTTTATGG - Intergenic
1151402055 17:73862199-73862221 CCGCTGGTTGCCCATTTTTATGG + Intergenic
1152463838 17:80454966-80454988 CCGCTGCCCGCAGCTTTTGGGGG + Intergenic
1154489072 18:14905191-14905213 CTGCTGTTTGCCCATTTTTGTGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157339100 18:46763290-46763312 CTGCTAACTGCACAGTTTTGCGG - Intergenic
1159113040 18:64082401-64082423 CCTCAGTCTCCACATTTTTGGGG + Intergenic
1160891628 19:1381683-1381705 CTGATGCCTGCACAGTTCTGAGG - Intergenic
1162577322 19:11506483-11506505 CCCATGCCTACACCTTTTTGAGG + Intronic
1165422510 19:35729254-35729276 CAGCAGCATGCACATTCTTGAGG - Exonic
1166476999 19:43135338-43135360 CTGCTGCTTGCCCATTTTTATGG + Intronic
925638017 2:5960559-5960581 CCGCTGCTTGCACCTTCATGTGG - Intergenic
925834204 2:7928440-7928462 CCCTTGCCTGCACATTCTAGGGG - Intergenic
925899631 2:8499649-8499671 CTGCTGCCTACACATTTGTGTGG + Intergenic
926245908 2:11122288-11122310 CTGCTGGCTGCACATTTTTATGG + Intergenic
926304948 2:11631151-11631173 CAGCTGCATGCACAGTGTTGTGG + Intronic
927301289 2:21518778-21518800 CAGTTGCCTGCTCATTTTTCTGG + Intergenic
930797535 2:55408675-55408697 CTGCTGATTGCCCATTTTTGTGG - Intronic
931018328 2:58012214-58012236 CTGCTGGTTGCCCATTTTTGTGG - Intronic
932819279 2:74885936-74885958 CTGCTGGTTGCACATTTTTATGG + Intronic
932827468 2:74955057-74955079 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
933228734 2:79781111-79781133 CTGCTGGTTGCTCATTTTTGTGG + Intronic
933916520 2:86999664-86999686 CAGATGCCTGCTCAATTTTGAGG - Intronic
934006473 2:87770262-87770284 CAGATGCCTGCTCAATTTTGAGG + Intronic
934035594 2:88086366-88086388 CCACTGACTGCACACTTTTCAGG - Intronic
935596881 2:104885735-104885757 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
935637039 2:105257055-105257077 CTGCTGGCTGCCCATTTTTATGG - Intergenic
935770127 2:106411170-106411192 CAGATGCCTGCTCAATTTTGAGG + Intronic
935886160 2:107621699-107621721 CAGCTGGTTGCCCATTTTTGTGG - Intergenic
935909968 2:107884754-107884776 CAGATGCCTGCTCAATTTTGAGG - Intronic
935968089 2:108501635-108501657 CAGATGCCTGCTCAATTTTGAGG - Intronic
936131752 2:109849884-109849906 CAGATGCCTGCTCAATTTTGAGG - Intronic
936212945 2:110521601-110521623 CAGATGCCTGCTCAATTTTGAGG + Intronic
936422085 2:112376157-112376179 CAGATGCCTGCTCAATTTTGAGG + Intronic
937453536 2:122022398-122022420 AAGCTGCCTGCAGATATTTGAGG - Intergenic
937712619 2:124995587-124995609 CCGTTGCCTTCAAATTCTTGAGG - Intergenic
938092641 2:128443427-128443449 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
940773105 2:157859399-157859421 CTGCTGGTTGCCCATTTTTGTGG - Intronic
941706555 2:168664542-168664564 CTGCTGCTTGCCCATTTTTATGG + Intronic
946037801 2:216757644-216757666 CCTCTGCCACCACATTTTTTTGG - Intergenic
1169022379 20:2339787-2339809 CCCCTGCCTGCACCTTGGTGAGG - Intronic
1170310523 20:14986372-14986394 CCGGTGGCTGCACATTTTTGTGG + Intronic
1170635060 20:18096973-18096995 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
1171398915 20:24859133-24859155 CCTCTGCCTGCACACTTTCTAGG + Intergenic
1172362320 20:34321895-34321917 CCGCTGGTTGCCCATTTTTATGG - Intergenic
1173492517 20:43494588-43494610 CTGCTGCTTGCCCATTTTTATGG + Intergenic
1174291050 20:49508830-49508852 GGGCTGCCTCCACATTTATGGGG - Intronic
1174558499 20:51413179-51413201 CAGTGGCCAGCACATTTTTGAGG + Intronic
1175144803 20:56887446-56887468 CTGCTGGTTGCACATTTTTATGG - Intergenic
1175572067 20:60031009-60031031 CTGCTGGTTGCACATTTTTATGG + Intronic
1175716841 20:61260689-61260711 GCTCTGCGTGCCCATTTTTGGGG - Intronic
1175938834 20:62528003-62528025 CCCCTACGTGCACATCTTTGGGG + Intergenic
1177879136 21:26670907-26670929 CAGCTGCCTGCCCCATTTTGTGG - Intergenic
1178617692 21:34147751-34147773 ATGCTGCCTGCATATTTGTGAGG + Intergenic
1179444589 21:41422379-41422401 CTGCTGGTTGCCCATTTTTGTGG - Intronic
949483790 3:4518472-4518494 CAGTTGCTTGCACATATTTGAGG + Intronic
949785185 3:7732896-7732918 CCGCTGGTTGCCCATTTTTATGG + Intronic
950686442 3:14621865-14621887 CATCTGCCTGCACCTTCTTGAGG + Intergenic
950782464 3:15403807-15403829 CTGCTGGTTGCCCATTTTTGTGG + Intronic
951485123 3:23202690-23202712 CCACTGCCTGCACCGTCTTGGGG + Intergenic
953521609 3:43648463-43648485 CTGCTGCTTGCCCATTTTTATGG + Intronic
955125574 3:56107571-56107593 TGGTTGCCTGCACATTTTTAGGG - Intronic
958038359 3:88195955-88195977 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
958674874 3:97255395-97255417 CCACTACCTGCACATTATTTGGG - Intronic
958896764 3:99838250-99838272 CCCGTGCCTGCCCATTTGTGTGG + Intronic
958967650 3:100576756-100576778 GAGCTGCCTGAAAATTTTTGTGG - Intronic
959989553 3:112615906-112615928 CTGCTGCTTGCCCATTTTTATGG - Intronic
960211617 3:114974612-114974634 CCACTGCATATACATTTTTGAGG + Intronic
965142717 3:164860704-164860726 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
966860292 3:184228016-184228038 CCACTGCCTGGACCTTTGTGAGG + Intronic
967336008 3:188345475-188345497 CTGTTTCCTGCACATTGTTGGGG + Intronic
968846287 4:3043582-3043604 CTGCTGGCTGCCCATTTTTATGG - Intergenic
969420449 4:7091292-7091314 CTGCTGGCTGCCCATTTTTATGG + Intergenic
969460609 4:7326901-7326923 CCGCTGCCTGCCCATCAATGGGG - Intronic
970469856 4:16366832-16366854 GGGCTGGCTCCACATTTTTGTGG + Intergenic
970962612 4:21890555-21890577 AAGCTGCCTGTACATTTTTAAGG - Intronic
971452323 4:26811670-26811692 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
972612569 4:40669138-40669160 CCGGTTCCTGCACAGTTTTCTGG - Intergenic
973754282 4:54058186-54058208 ACCCTGCATGCACATTTTTTTGG - Intronic
974906580 4:68065815-68065837 CCTCTGCCTGCTCATTTTTAGGG - Intronic
975837394 4:78439166-78439188 CCGCTGCCTGGATATTTTGGGGG - Intronic
976364503 4:84218106-84218128 CCTCTGCCTGTGCATTTTTGTGG - Intergenic
983221842 4:165051330-165051352 CTGCTGGCTGCCCATTTTTATGG - Intergenic
987137607 5:14914287-14914309 CTGCTGCCCGCCCATTTTTTGGG + Intergenic
990420289 5:55625287-55625309 CTGCTGGCTGCCCATTTTTATGG - Intergenic
990600153 5:57350347-57350369 CTGCTGGTTGCACATTTTTATGG + Intergenic
995982714 5:118124855-118124877 CTTCTCCCTGTACATTTTTGGGG - Intergenic
996684840 5:126268831-126268853 CTGCTGGCTGCCCATTTTTATGG + Intergenic
997341325 5:133147320-133147342 CTGCTGGCTGCCCATTTTTATGG - Intergenic
1001370564 5:171196297-171196319 CTTCTCCCTGCACATTTTGGTGG + Intronic
1001972705 5:175969133-175969155 CCGCTGGTTGCGCATTTTTATGG - Intronic
1002244733 5:177874649-177874671 CCGCTGGTTGCGCATTTTTATGG + Intergenic
1002346130 5:178548257-178548279 CTGCTGCCTCCACCTTTTTTGGG + Intronic
1004789831 6:19012565-19012587 CCGCTGCCTAATCAGTTTTGGGG - Intergenic
1005650799 6:27883119-27883141 CTGCTGCTTGCCCATTTTTATGG - Intergenic
1008911611 6:56739864-56739886 CTGCTGGTTGCTCATTTTTGTGG - Intronic
1012411531 6:98963810-98963832 CTGGGTCCTGCACATTTTTGAGG - Intergenic
1012524872 6:100165379-100165401 CCACTGCAGGCACATTTATGGGG - Intergenic
1015632624 6:135246711-135246733 CCGCTGGTTGCCCATTTTTATGG + Intergenic
1019545390 7:1571983-1572005 CTGCTGGTTGCCCATTTTTGTGG + Intergenic
1019810148 7:3159159-3159181 CTGCTGGTTGCCCATTTTTGTGG + Intronic
1019946559 7:4334166-4334188 CTGCTGCTTGCCCATTTTTATGG - Intergenic
1019951481 7:4376559-4376581 CTGCTGCTTGCCCATTTTTATGG - Intergenic
1020014802 7:4824685-4824707 CCGCTGCCTGCTCATGTGTCTGG + Intronic
1020804571 7:12772675-12772697 CCGCTGGTTGCCCATTTTTATGG + Intergenic
1021820616 7:24494382-24494404 CAGCTGACTGCACTTTTTTGAGG - Intergenic
1024039573 7:45541871-45541893 CCGCTGCCTGAACATTCTCCAGG - Intergenic
1024484814 7:49906066-49906088 CCACTGGCTGCCCATTTTTATGG - Intronic
1025019974 7:55473096-55473118 CTGCAGCCTGCACATACTTGCGG - Intronic
1026861271 7:73791566-73791588 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
1027125967 7:75556936-75556958 CCACACCCTGCACTTTTTTGGGG - Intronic
1031704713 7:124965405-124965427 CTGCTGCTTGCCCATTTTTATGG + Intergenic
1032864225 7:135909793-135909815 CTGCTGCTTGCCCATTTTTGTGG - Intergenic
1033351508 7:140566016-140566038 CTGCTGGTTGCCCATTTTTGTGG - Intronic
1034064987 7:148127504-148127526 CCGCTGCCTGCACATTTTTGTGG - Intronic
1035174485 7:157040434-157040456 GCGATGCCTGCACGTTTTCGCGG - Intergenic
1035924850 8:3716377-3716399 CCGCTGGTTGCCCATTTTTATGG + Intronic
1036973318 8:13380444-13380466 CCCCTTCCTCCACCTTTTTGTGG + Intronic
1037367608 8:18139692-18139714 CTGCTGGTTGCTCATTTTTGTGG + Intergenic
1038645714 8:29360160-29360182 CTGCTGGCTGCCCATTTTTATGG - Intergenic
1038655585 8:29448179-29448201 CTGCTGGCTGCCCATTTTTATGG - Intergenic
1039606526 8:38885144-38885166 GCCCGGCCTGCACATTTTTTAGG + Intergenic
1042309605 8:67367106-67367128 CCGCTGGTTGCCCATTTTTATGG - Intergenic
1042948388 8:74176952-74176974 CTGCTGATTGCCCATTTTTGTGG - Intergenic
1044561461 8:93616725-93616747 TCTCTGCCTTCACTTTTTTGGGG - Intergenic
1045253150 8:100497924-100497946 CTGCTGGCTGCCCATTTTTATGG + Intergenic
1045290567 8:100829032-100829054 CCGCTGGTTGCCCATTTTTATGG - Intergenic
1048875272 8:138832210-138832232 CTGCTGACTGCCCATTTTTATGG - Intronic
1050104008 9:2146669-2146691 CTGCTGCTTGCCCATTTTTGTGG + Intronic
1051785626 9:20739993-20740015 CATCTGCCTACACATTCTTGGGG - Intronic
1053666107 9:40318805-40318827 CCGCAGGCTGCACAGTTTGGAGG + Intronic
1054518502 9:66057478-66057500 CCGCAGGCTGCACAGTTTGGAGG - Intergenic
1056469892 9:86895067-86895089 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
1056739488 9:89241849-89241871 CTGCTGGTTGCACATTTTTATGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057818369 9:98312581-98312603 CCACTGCGTGAACATTTGTGGGG - Intronic
1058118963 9:101117562-101117584 CTGCTGGCTGCCCATTTTTATGG - Intronic
1060793882 9:126502261-126502283 CAGCTGCCAGCCCATTTCTGTGG + Intronic
1190408344 X:50110125-50110147 CCGTAGCCTCCAAATTTTTGAGG - Intergenic
1190815157 X:53923333-53923355 CTGCTGGTTGCACATTTTTATGG - Intergenic
1191657541 X:63614262-63614284 CTGCTGCCTGCTCCTTTTTCTGG - Intergenic
1191663930 X:63678467-63678489 CCGCTACCAGCACTTCTTTGAGG - Exonic
1196707211 X:118727257-118727279 CCGCTGCCAGCACACTTGCGGGG - Intergenic
1196870436 X:120108484-120108506 CCCCTTCTTGCACATATTTGTGG + Intergenic
1198577626 X:138027065-138027087 CTGCTGGTTGCCCATTTTTGTGG - Intergenic
1199990997 X:152987776-152987798 CCCCTCCCTGCACATGTGTGGGG - Intergenic
1200034084 X:153317250-153317272 CCCCTCCCTGCACATGTGTGGGG - Intergenic