ID: 1034067609

View in Genome Browser
Species Human (GRCh38)
Location 7:148151980-148152002
Sequence CCTTCCTTCCGGAACCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034067609_1034067614 23 Left 1034067609 7:148151980-148152002 CCACCTAGGTTCCGGAAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1034067614 7:148152026-148152048 AACAGACTGCAAATAGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034067609 Original CRISPR CCTTCCTTCCGGAACCTAGG TGG (reversed) Intronic
901310807 1:8268172-8268194 CCTTCATTAAGGAACCAAGGAGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
906551113 1:46667437-46667459 CCTTCCCTCTGGAAGCTAAGAGG + Intronic
917692833 1:177486736-177486758 CCTTCCTTGTGGAAACTGGGAGG - Intergenic
921968204 1:221116158-221116180 CCTTCCTTCCTGGATCTTGGAGG + Intergenic
922727041 1:227927436-227927458 CCTTCCTTCCCTCACCCAGGCGG - Intronic
1062921113 10:1280452-1280474 CCTTGCTTCCAGCATCTAGGAGG + Intronic
1067080761 10:43211041-43211063 CCTTCCTGCCTGAACAGAGGAGG - Intronic
1071466266 10:85942431-85942453 CCTTCCTTCCCCACACTAGGGGG + Intronic
1075762072 10:124864598-124864620 CCTTCCTTCCACCACATAGGTGG + Intergenic
1076362212 10:129897272-129897294 CTTTCCTGCAGGGACCTAGGAGG + Intronic
1078355590 11:10629479-10629501 CCTTCCCTCCCGACCCTAGAGGG + Intronic
1078469984 11:11578973-11578995 CCTTCCTTCCTGAAGCCAGGGGG - Intronic
1079704255 11:23593866-23593888 ACTTTCTCCCCGAACCTAGGAGG + Intergenic
1083794420 11:65006668-65006690 CCCTCACTCCGGAACCTAAGAGG - Intergenic
1084304044 11:68270250-68270272 CCTTCCTTGCAGATCCTATGGGG - Intronic
1085018322 11:73189673-73189695 GCTTCCTCCCTGACCCTAGGGGG + Intergenic
1088674535 11:112179761-112179783 CCTTCCTTCAGGAACTTGTGGGG - Intronic
1089345918 11:117791658-117791680 CCTTCCATCCGTCACCTAGCTGG - Intronic
1092187693 12:6493310-6493332 CCCTCCTGCCGGAACCCGGGGGG - Exonic
1093477800 12:19574233-19574255 GCTTCCCTCAGGAACCTGGGGGG + Intronic
1096334189 12:50740698-50740720 CCTTCCTTCTGTATCCTAGCTGG + Intronic
1101739532 12:107490197-107490219 CCCGCCTTCAGGAACCTGGGCGG - Intronic
1102636871 12:114332381-114332403 CCTTCCTTCTTGAATCCAGGTGG + Intergenic
1104860830 12:131922557-131922579 CCTGCCTTCCGGATTCCAGGCGG + Exonic
1107146126 13:37062117-37062139 CCTGCCTTCTGGACCCTAGGTGG + Intergenic
1110827609 13:79990842-79990864 CATTCCTTCCAGAAGCTTGGGGG - Intergenic
1112088078 13:96052990-96053012 CCTTCCTTCCCGACCCGGGGCGG - Intronic
1118662804 14:68033096-68033118 CCTGCCTTCTGGAATCTTGGGGG - Intronic
1126719507 15:51562373-51562395 CCTTTCTTCAGGAACCTATTGGG + Intronic
1132716313 16:1291860-1291882 CCTTCCTCCTGAAACCTGGGTGG + Intergenic
1138062901 16:53910205-53910227 CAGTACTTCCGGTACCTAGGTGG + Intronic
1140838906 16:78820792-78820814 CGTTCCTTCTGGAAGCTATGAGG + Intronic
1141417851 16:83890693-83890715 CGTTCCTTCCGGAGCCTCTGAGG + Intergenic
1143772714 17:9178799-9178821 CCTGCCTCCCTGAAGCTAGGCGG - Intronic
1147553866 17:41464033-41464055 CCATCCCTCCGGATCCTAGGCGG - Intronic
1149806395 17:59620923-59620945 CCTACCTTCCAGAACCAAAGAGG - Intronic
1151062588 17:71113305-71113327 CCTTCCTTCTGGATCCTAGCAGG + Intergenic
1161868289 19:6850782-6850804 CCAGCTTTCCAGAACCTAGGAGG + Intronic
1162894800 19:13758860-13758882 CATTTCATCCGGAACCTGGGAGG - Exonic
1163131550 19:15276573-15276595 CCTGCCTTCAGGTTCCTAGGGGG - Intronic
926410182 2:12594870-12594892 CCTTTCTTCCAGATCCGAGGAGG - Intergenic
930084902 2:47489545-47489567 CCTTCCTTCTGTAACTTAAGGGG + Intronic
934573236 2:95384927-95384949 CGTTCCTCCCGGGACCTAAGAGG - Exonic
946846185 2:223860789-223860811 CCTTCTTCCAGGAAACTAGGGGG + Intronic
948692046 2:239712226-239712248 CCTTCCTTCTGGAACTTAGTGGG - Intergenic
1169021394 20:2333857-2333879 CCTCCCTTTCTGAACCTCGGAGG + Intronic
1170782889 20:19441269-19441291 CATTACTTCCGGCCCCTAGGTGG - Intronic
1175926620 20:62474446-62474468 CCGTCCCTCCGGGACCTTGGAGG - Intronic
1179186751 21:39090671-39090693 CCTTCCATCAGCAACCTGGGAGG + Intergenic
1179730397 21:43364292-43364314 TCTTCCTTCTGGAACCAGGGTGG - Intergenic
1180790663 22:18573915-18573937 CCTTCCCTCCTGAACTTTGGCGG + Intergenic
1181231074 22:21421399-21421421 CCTTCCCTCCTGAACTTTGGCGG - Intronic
1181247574 22:21513469-21513491 CCTTCCCTCCTGAACTTTGGCGG + Intergenic
1183646484 22:39130094-39130116 CCTTTATTCCAGAACCTTGGAGG - Intronic
1184244210 22:43227696-43227718 CCTTCCCCCAGGAACCTGGGTGG + Intronic
1185072852 22:48666839-48666861 CATTCCATCCGGAGCCCAGGAGG + Intronic
950054275 3:10012288-10012310 CCTTCCTTGTGGAACCAAAGAGG + Intergenic
950305460 3:11912724-11912746 CCTTCCTTGTGGAACCAAAGAGG + Intergenic
950789966 3:15463774-15463796 CATGCCTTCCAGAACCAAGGAGG + Intronic
953030739 3:39178136-39178158 CCTGCCTTCCGGGACGCAGGTGG + Intergenic
957668439 3:83268109-83268131 CCTTCCTTCTGGAACTGAGTTGG + Intergenic
958433138 3:94065387-94065409 CCTTCTTCCCTCAACCTAGGAGG - Intronic
960272346 3:115688898-115688920 ACTTACTTCCGCAGCCTAGGAGG + Intronic
967172292 3:186831137-186831159 CCTTCTTTCCGGTCCATAGGTGG - Intergenic
969096269 4:4735092-4735114 CTTCCCTTCCGGAACTTGGGGGG - Intergenic
969926378 4:10589638-10589660 CCTCCCTCCCAGACCCTAGGCGG - Intronic
972560562 4:40224501-40224523 CCTTACTTCCTGTACTTAGGGGG - Intronic
973197586 4:47463415-47463437 CCTTCCCTGGGGAGCCTAGGAGG - Intronic
985139511 4:186824688-186824710 CTTTCCTCCTGGAACCAAGGTGG + Intergenic
996260423 5:121460350-121460372 CCTTCCATCCGGAATTTATGTGG + Intergenic
997634319 5:135393639-135393661 CCTTCCTTCAGTAAACCAGGAGG + Intronic
1003744690 6:8987376-8987398 CATTACTTCAGGTACCTAGGTGG + Intergenic
1007330190 6:41100993-41101015 CCCTGTTTCCGGTACCTAGGCGG + Intergenic
1013743826 6:113320863-113320885 GCTTCCTTCTGGAACCTGGAGGG - Intergenic
1014918041 6:127177385-127177407 CCTTCCTTCTTGAACCCAGCTGG + Intronic
1015377797 6:132530410-132530432 CCTTCCCTGCAGAACCCAGGAGG - Intergenic
1018656180 6:166038720-166038742 CCTTCCTGCCTTAATCTAGGAGG + Intergenic
1019577235 7:1743437-1743459 CCTTCCTTCCAGAAGGGAGGTGG + Intronic
1021451803 7:20789157-20789179 ACTTCCTTCCAGAAGATAGGAGG - Intergenic
1022520057 7:31000439-31000461 CATTGCTTCCGGAACCTGTGCGG + Intergenic
1034067609 7:148151980-148152002 CCTTCCTTCCGGAACCTAGGTGG - Intronic
1034445908 7:151114439-151114461 CCTACCTGCCGGATCCTAGGAGG + Intronic
1036946450 8:13099385-13099407 CCTTCTTTCCGGGATCTCGGAGG + Exonic
1055756443 9:79563439-79563461 CCTTCCTTCCAAAACCTTGTTGG - Intergenic
1186004945 X:5059406-5059428 CCTTCCTTCCTGAACTGAGCTGG - Intergenic
1186573772 X:10744006-10744028 TCTTCCTTCTCTAACCTAGGGGG - Intronic