ID: 1034074693

View in Genome Browser
Species Human (GRCh38)
Location 7:148220400-148220422
Sequence CATAGTTAACATTATGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034074693 Original CRISPR CATAGTTAACATTATGATGT TGG (reversed) Intronic
901819436 1:11817565-11817587 CATATTTAACAATGTGAAGTCGG - Intronic
907116644 1:51974779-51974801 CACAATTAACACTATGAAGTAGG - Intronic
907589416 1:55651996-55652018 CTTAGTTAACAGTAGGACGTGGG - Intergenic
909183002 1:72449364-72449386 CAGAGTTCACATGATGATATTGG + Intergenic
909544580 1:76831640-76831662 CAATGTTAACATGATGTTGTTGG - Intergenic
912100273 1:106194943-106194965 CAAAGTTAATATTAATATGTAGG - Intergenic
912719623 1:112008807-112008829 CATAGTGAACAAGCTGATGTGGG - Intergenic
915924643 1:160006612-160006634 AATACTTGACCTTATGATGTCGG - Intergenic
916058592 1:161084364-161084386 CATAGTAAATATTTTGCTGTCGG + Intronic
917559777 1:176137968-176137990 CATAGCAAGCATTATGATGATGG + Intronic
918503482 1:185225027-185225049 CATAGTTAACATCATACTGAAGG - Intronic
919169003 1:193930398-193930420 CAAAGGTAGCCTTATGATGTTGG - Intergenic
919956482 1:202421963-202421985 CTTAGGCAACATTATGAAGTAGG - Intronic
920268171 1:204742584-204742606 CATACTTAACATTTTTATGCAGG - Intergenic
1066276649 10:33875623-33875645 AATATTTAACATTATTATGACGG - Intergenic
1067992716 10:51233462-51233484 AATAGTTAGCATTCTGATATGGG + Intronic
1070101544 10:73392355-73392377 CTTTGTTATCATGATGATGTTGG - Intronic
1071979282 10:90987427-90987449 CCTAGTAAAAATGATGATGTTGG - Intergenic
1073624135 10:105079076-105079098 CATAGATGACATGATGATGATGG - Intronic
1076112194 10:127869170-127869192 CAACATTAACATTGTGATGTAGG + Intergenic
1078883438 11:15476331-15476353 CATTGTTACCATTATGACTTGGG - Intergenic
1079567963 11:21906253-21906275 CATAATTAAATTTATGAGGTAGG - Intergenic
1082899709 11:58234090-58234112 CATTGTTAATATTTTGAAGTAGG - Intergenic
1086024024 11:82268431-82268453 TATATGTAACATTTTGATGTAGG - Intergenic
1086320661 11:85643824-85643846 TATAATTAACATGATGATGGTGG + Intergenic
1086600829 11:88631116-88631138 CATAGTTGTCATGGTGATGTGGG + Intronic
1086698300 11:89869529-89869551 CAAAGATAACACTATTATGTTGG - Exonic
1086707864 11:89974959-89974981 CAAAGATAACACTATTATGTTGG + Exonic
1086917635 11:92549027-92549049 GACAGTTAACATTAAGATCTTGG - Intronic
1087714031 11:101586093-101586115 CATAGATAACTATATAATGTGGG - Intronic
1088089854 11:106024946-106024968 CATAGTTACCATTATTTGGTGGG + Intergenic
1091041737 11:132287250-132287272 CATAGTCAGAATTATGATTTTGG + Intronic
1091572921 12:1706073-1706095 GAGAGATAACATCATGATGTGGG + Intronic
1093680971 12:22003096-22003118 CTTAGTTAACATTATTATCATGG + Intergenic
1094210127 12:27881006-27881028 CATAGTTAACATTATACTCATGG - Intergenic
1095469943 12:42525809-42525831 CATCAACAACATTATGATGTAGG - Intronic
1097432206 12:59524247-59524269 TATAGTCACCATTATGATGTAGG - Intergenic
1097508442 12:60505967-60505989 TGTAGTTAACATTATAATGCTGG + Intergenic
1099656998 12:85505933-85505955 TATAGTTAACATTATTTTGTAGG + Intergenic
1101796017 12:107975089-107975111 TATAGTCACCATTATGATGCAGG + Intergenic
1101842098 12:108335060-108335082 CTTAGTTAACATGGTGATGTTGG - Intronic
1102743675 12:115230992-115231014 AATATTTAACATGATGCTGTCGG - Intergenic
1102973191 12:117187578-117187600 CATACTTAACATTAATCTGTGGG - Intronic
1103087912 12:118076204-118076226 CAAGGTTAACATCAAGATGTTGG + Intronic
1103100066 12:118166013-118166035 CACATTAAACATTATTATGTAGG - Intronic
1104133332 12:125915463-125915485 CATTGTTAACACTAAGATGTTGG - Intergenic
1106113432 13:26797005-26797027 GATAGTCAACATGAGGATGTAGG - Intergenic
1107129065 13:36875654-36875676 CATCGTTAACATTTTGATGAAGG - Intronic
1108434556 13:50389039-50389061 TTTATTTAACATTATGATGTAGG + Intronic
1108754966 13:53488901-53488923 CATATTTATCATTTTCATGTGGG - Intergenic
1108875449 13:55043275-55043297 CATATTTAAATTTATGATTTTGG - Intergenic
1109103272 13:58213916-58213938 CAAAGTAAAAAGTATGATGTGGG + Intergenic
1109683555 13:65784229-65784251 CATAGTCAACATGTTGATGGCGG - Intergenic
1110024784 13:70522549-70522571 CATATTTAAAATTAGGATGCAGG + Intergenic
1111349352 13:87005859-87005881 CATGTTTAATATTATCATGTTGG - Intergenic
1114841657 14:26269878-26269900 TATAGTAATCATGATGATGTAGG - Intergenic
1115571954 14:34675069-34675091 CATAGTTTACATTAGGATTTAGG - Intergenic
1117551196 14:56838276-56838298 CATAGTTACCATTGTGTGGTGGG - Intergenic
1117871681 14:60207640-60207662 CATTGTTATCATTATCAGGTGGG + Intergenic
1118193688 14:63604837-63604859 GATAGTTAAGATTATAATGGAGG + Intronic
1118901081 14:69986503-69986525 TATAGTTAGCATAATGATATGGG - Intronic
1119800582 14:77441548-77441570 CATAATTAACATTACCATTTTGG + Intronic
1120024229 14:79564456-79564478 CTTAGCTAACATTATCATCTTGG - Intronic
1120058480 14:79953814-79953836 CATAGGTAAGATTATAAAGTAGG + Intergenic
1123679097 15:22744437-22744459 CATATTTAATATTAAGTTGTTGG + Intergenic
1124331305 15:28818737-28818759 CATATTTAATATTAAGTTGTTGG + Intergenic
1126346739 15:47703404-47703426 CATAGTTAAATTTATGACATAGG + Intronic
1126920398 15:53515549-53515571 CATAGTTAATGGTATGATATTGG + Exonic
1127129830 15:55851023-55851045 GTTAGTTAACAGTATGCTGTGGG + Intronic
1131821893 15:96282182-96282204 CATTGTTAACAACTTGATGTGGG - Intergenic
1138591826 16:58003764-58003786 TTTATTTAATATTATGATGTGGG + Intronic
1138854659 16:60674974-60674996 CATACATAAAATTATTATGTAGG - Intergenic
1141582308 16:85008181-85008203 CTCAGCTAACAATATGATGTAGG + Intronic
1150867372 17:68867528-68867550 CACAGGTAACACCATGATGTAGG - Exonic
1153035456 18:757919-757941 CATAGTAAACCTTATGAGGTAGG - Intronic
1154158594 18:11962873-11962895 CAAAGTTTACATTATGCCGTTGG + Intergenic
1156849956 18:41714693-41714715 CATTGTTAGCATTATAGTGTGGG - Intergenic
1164064351 19:21702759-21702781 CATAGTTGACATCATTATATTGG - Intergenic
1164266950 19:23628208-23628230 CATAGTTGACATTATGATGTTGG + Intronic
1164761625 19:30732686-30732708 CATGGTTACCTTTAGGATGTTGG - Intergenic
1164761643 19:30732791-30732813 CATGGTTACCTTTAGGATGTTGG - Intergenic
1164761696 19:30733078-30733100 CATGGTTACCTTTAGGATGTGGG - Intergenic
1165815001 19:38636516-38636538 CCTAGTAAATATTATCATGTAGG + Intronic
1167981354 19:53278838-53278860 CATAGCTATCATTATGTTGAAGG + Intergenic
926329977 2:11816455-11816477 CATAGTTAGTGTTAGGATGTCGG - Intronic
926441839 2:12897260-12897282 CAGAGTTAAAATTATTAGGTAGG + Intergenic
926790871 2:16570269-16570291 CCTGGTTACCATTAAGATGTAGG + Intronic
927593440 2:24376511-24376533 CATTGTTAACCTTTTGGTGTGGG + Intergenic
931325558 2:61218463-61218485 CACAGTTAACACTATTATGATGG + Intronic
932639649 2:73430850-73430872 CATAGATCACTTAATGATGTGGG - Intronic
933007259 2:77011730-77011752 TATAGTTAACATTATCTTATTGG + Intronic
933007427 2:77013810-77013832 TATAGTTAACATTATCTTATTGG - Intronic
935332220 2:101985609-101985631 CACAGGTATCATTATGATTTAGG + Intergenic
938825941 2:135005383-135005405 CAAAGATAACATTATCATATGGG - Intronic
940978549 2:159974627-159974649 CATATTGAACATTATGGTTTTGG + Intronic
941109703 2:161405835-161405857 CAAAGTTAACATGTTAATGTGGG + Intronic
942901917 2:181130035-181130057 AACAGATAACATTATGATGTAGG - Intergenic
945466678 2:210177513-210177535 CATAGAAAACCTTATGATTTGGG + Intergenic
1170127473 20:12980746-12980768 AATAGGTAACATTATTAGGTTGG + Intergenic
1170218343 20:13915766-13915788 GATAGGTAAGATTAAGATGTGGG + Intronic
1173683628 20:44907139-44907161 CATAGTGAACATATTGCTGTAGG - Exonic
1173685066 20:44917573-44917595 CGAAGTTAACAGTATGATGAGGG - Intronic
1175548215 20:59794199-59794221 CATAGTTAACATCATTTTGAAGG - Intronic
1177803735 21:25853931-25853953 CATAGTTGGCATTTTGATGCTGG + Intergenic
1177997863 21:28124292-28124314 CATAGTTTAAACTATTATGTTGG + Intergenic
1178852632 21:36225976-36225998 CCTAGTTAAAATTGTGCTGTTGG + Intronic
1178966898 21:37128772-37128794 AATAGTGATCATTATGATTTAGG - Intronic
949264844 3:2144659-2144681 CATTATTAACATTAGGATGTGGG - Intronic
949793209 3:7816461-7816483 CATTATTAACACTATGTTGTAGG + Intergenic
951275917 3:20685911-20685933 CAAAGTTAACATTATGAGAATGG - Intergenic
952489614 3:33854999-33855021 CATATTTAATATTAAGTTGTTGG + Intronic
952510701 3:34051857-34051879 CCAAGTTAACATATTGATGTTGG - Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955585917 3:60477765-60477787 CATAGTAAACATTTTTATCTTGG + Intronic
957263815 3:77934853-77934875 CAAAGATAACATTTTGAAGTAGG + Intergenic
957277061 3:78104108-78104130 CAGAGTGAACTTTATGATCTTGG - Intergenic
957816498 3:85305646-85305668 CATGGTTAATATTCTGATTTTGG - Intronic
959137248 3:102438785-102438807 CATAGTTAATATTATTATAATGG + Intronic
959435625 3:106311448-106311470 CATAGTTAAAAATCTGATGGAGG + Intergenic
959672022 3:108989756-108989778 CACAGTTAACATTATGTTCCAGG + Intronic
960352817 3:116613850-116613872 CAAAGTGAAGATTATTATGTGGG + Intronic
960884678 3:122382469-122382491 CATATTTAAGATCATGATTTTGG + Intronic
962857514 3:139361351-139361373 CACAGTTAACAGAATAATGTTGG - Intronic
963817257 3:149845398-149845420 CATAGTGAACAGGATGAAGTTGG + Intronic
964099514 3:152972155-152972177 CATAGTCAATAATATAATGTTGG - Intergenic
964574477 3:158149645-158149667 CATAGTGAACATGATGCTATAGG + Intronic
965142921 3:164862761-164862783 CAAGGCTGACATTATGATGTTGG - Intergenic
965958092 3:174396120-174396142 CATTGATGACATTATGATGATGG + Intergenic
967416866 3:189228640-189228662 TATAGATAACATCATGCTGTTGG + Intronic
967604419 3:191427413-191427435 CATAGTGGACATTAAGATGTAGG - Intergenic
967821550 3:193843518-193843540 TGTTGTTAACATGATGATGTTGG - Intergenic
970360785 4:15307017-15307039 CATAGATACAATTATGAAGTTGG + Intergenic
970915883 4:21334321-21334343 CAAAGTTAACATTATTTTTTTGG - Intronic
971714377 4:30156310-30156332 CCTAGTTCACATTAAGCTGTGGG + Intergenic
974072634 4:57138822-57138844 CATAATTTACAATATGATTTTGG + Intergenic
974112633 4:57543261-57543283 AATTGTTAACATAATGAGGTGGG - Intergenic
980005437 4:127537026-127537048 TATAGTTAACAGTATGGTATTGG - Intergenic
981394196 4:144227867-144227889 TATAGTAAACAATTTGATGTAGG + Intergenic
982949190 4:161667484-161667506 TGTAGGTAACATTATAATGTTGG + Intronic
982986808 4:162219464-162219486 CATATTTAATATTAATATGTGGG + Intergenic
983631483 4:169853702-169853724 CTTGGTTAACAATATGATGTAGG + Intergenic
984389518 4:179110877-179110899 CATGGTTAAAATTAAGGTGTTGG + Intergenic
984681404 4:182614110-182614132 CATAGTTTACATTGTAATGTTGG + Intronic
986120594 5:4832228-4832250 CATAGCTAACAAGGTGATGTAGG - Intergenic
989281594 5:39650211-39650233 CATATTCAACAATATGATTTGGG + Intergenic
989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG + Intergenic
990300900 5:54448387-54448409 CCTAGTTTACATTAGGCTGTAGG + Intergenic
992951287 5:81860516-81860538 CATACTTAACAATACGATCTGGG + Intergenic
994070735 5:95599072-95599094 CAGAGCTAACATTCTAATGTGGG - Intronic
994357718 5:98812729-98812751 CATAGTGAACATAGTGTTGTTGG - Intergenic
995134333 5:108664364-108664386 CATAGTGAAAATTATGAGTTAGG + Intergenic
995458522 5:112377646-112377668 GATAGTTAATATTATGTTGAGGG - Intronic
995571401 5:113486210-113486232 CACAGTTAAAGTTATGATTTAGG + Intronic
995714153 5:115065505-115065527 TATTGTGAAAATTATGATGTTGG + Intergenic
995958626 5:117811652-117811674 CATAGTAAACATTTTCATCTTGG + Intergenic
997147142 5:131447626-131447648 CATAGATAACCTTATTATTTTGG - Intronic
998782945 5:145678518-145678540 CATATTTAGCATTATGATTTAGG - Intronic
999937718 5:156505517-156505539 CATAGATAACATAGTGAGGTAGG + Intronic
1000232125 5:159325817-159325839 AATCGCCAACATTATGATGTTGG + Intronic
1000438232 5:161239868-161239890 CATAGTTAACTTTGTAATGCAGG - Intergenic
1002900648 6:1407169-1407191 CAGACTTAACATTTTCATGTGGG - Intergenic
1005018598 6:21396642-21396664 CATTGTTAACATTCTGATTTTGG + Intergenic
1009663193 6:66641523-66641545 TATTTTTAACATTTTGATGTGGG - Intergenic
1009803767 6:68575637-68575659 CACAGTTAACAATATGACCTAGG + Intergenic
1011567150 6:88688278-88688300 CAGAATTAACATTTTGATGTTGG + Intronic
1014794743 6:125711921-125711943 CCTAGAAAACATTATGTTGTTGG + Intergenic
1016392431 6:143588275-143588297 AGTACTAAACATTATGATGTTGG + Intronic
1016426447 6:143941094-143941116 TTTAGTTAACATTATGATCATGG + Exonic
1018099065 6:160420403-160420425 GATAGTTAACATTTTGATAAAGG - Intronic
1018266624 6:162031061-162031083 CATAAGTAACACTTTGATGTTGG + Intronic
1019180372 6:170183599-170183621 GATAGTGATCATGATGATGTTGG + Intergenic
1020517933 7:9148564-9148586 CATATTTAAAATTAAGATGAAGG + Intergenic
1023809991 7:43904775-43904797 CATAGTACACCTTACGATGTAGG - Intronic
1027533563 7:79366822-79366844 CATAGGATATATTATGATGTTGG + Intronic
1028827864 7:95294457-95294479 AATGGTTTACATTATGATGGGGG + Intronic
1029815601 7:103091459-103091481 GATAGTTAACAATATTATGAAGG + Intronic
1031897820 7:127372568-127372590 CATAGTTAATATTATTAACTAGG - Intronic
1032724741 7:134580443-134580465 AATTGTTAACATTTTAATGTTGG - Intergenic
1033823357 7:145160349-145160371 CACAGTTTATATTATGAAGTTGG + Intergenic
1034074693 7:148220400-148220422 CATAGTTAACATTATGATGTTGG - Intronic
1039652447 8:39357013-39357035 CATAGGTAAAATTAAAATGTAGG + Intergenic
1043335259 8:79168157-79168179 CTTAGTTAATATTATTATATTGG + Intergenic
1046156013 8:110290946-110290968 CATAGGTAACATTATGAAAAAGG + Intergenic
1046857022 8:119044044-119044066 CATATTTACCATTAGGCTGTTGG + Intronic
1047347635 8:124043404-124043426 CTTAGCTAACATTTTGATGATGG - Intronic
1050769882 9:9184677-9184699 CATAGTTTACAATCTAATGTGGG - Intronic
1052012449 9:23426572-23426594 CATAGTGATCATTATTATTTAGG - Intergenic
1052488404 9:29131728-29131750 CATAGCTTACATGATCATGTAGG - Intergenic
1055224463 9:73977572-73977594 CATAGTTATGCTTATGATGAAGG + Intergenic
1056914748 9:90736226-90736248 CATGATTAAAATTAAGATGTTGG - Intergenic
1057445038 9:95107880-95107902 TATAATTACCATTATTATGTGGG - Intronic
1188983291 X:36747802-36747824 CATAGTCAACATTATACTGAAGG - Intergenic
1189100802 X:38187531-38187553 CATAGTTTACACTTTGAGGTAGG + Intronic
1189664617 X:43340509-43340531 TCTCTTTAACATTATGATGTAGG - Intergenic
1191652333 X:63553020-63553042 CATATTTATGATTATGATGATGG + Intergenic
1194152013 X:90337693-90337715 CATAAATAACATGATGCTGTGGG - Intergenic
1195881711 X:109599949-109599971 CAGTGTTAACAGTTTGATGTGGG - Intergenic
1197441593 X:126497688-126497710 CATTGTTTATTTTATGATGTCGG - Intergenic
1199803912 X:151278983-151279005 CATAACTAAAATTTTGATGTAGG - Intergenic
1200419943 Y:2954381-2954403 CAAGGTTAAAATTAAGATGTTGG + Intronic
1202578115 Y:26349213-26349235 CTTAGGCAACATTATGAAGTGGG + Intergenic