ID: 1034077760

View in Genome Browser
Species Human (GRCh38)
Location 7:148249230-148249252
Sequence CAGTGGGTTTGGTGGTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034077760_1034077766 13 Left 1034077760 7:148249230-148249252 CCTTCTCACCACCAAACCCACTG 0: 1
1: 0
2: 4
3: 45
4: 363
Right 1034077766 7:148249266-148249288 TCTCCTGCTGCTCCACTTAAAGG 0: 1
1: 0
2: 0
3: 11
4: 163
1034077760_1034077769 30 Left 1034077760 7:148249230-148249252 CCTTCTCACCACCAAACCCACTG 0: 1
1: 0
2: 4
3: 45
4: 363
Right 1034077769 7:148249283-148249305 TAAAGGCAGCATCTGAAACCAGG 0: 1
1: 0
2: 7
3: 44
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034077760 Original CRISPR CAGTGGGTTTGGTGGTGAGA AGG (reversed) Intronic
901008981 1:6187908-6187930 CTGTGTGTTGGGTGGTGAGCAGG - Intronic
904386940 1:30149034-30149056 TACAGGGTTTGGTGGTGAGAGGG - Intergenic
904517165 1:31065513-31065535 GAGTGGTTGTGGGGGTGAGAAGG - Intronic
904846902 1:33426671-33426693 CTGTGAGTTTGCTGGTGTGAAGG - Intronic
905653647 1:39672311-39672333 CAGCCGGTTGGGTGGTGAGGGGG + Intergenic
906746527 1:48225936-48225958 GAGTGGGGAAGGTGGTGAGAAGG - Intronic
907121596 1:52012798-52012820 CATTGGGGATGGGGGTGAGAAGG - Intergenic
907607174 1:55829650-55829672 CACTGGGAATGTTGGTGAGAGGG + Intergenic
907814170 1:57901819-57901841 CAGTGGGGTTGGCTGTGAGAAGG - Intronic
912249525 1:107996554-107996576 CTGTGTGTTTGGTGCTGAGTGGG + Intergenic
912617625 1:111121105-111121127 CAGTGTGTCTGATGGTGAAAAGG + Intronic
914399373 1:147302806-147302828 CAGAGGGTTGGGTGGTTAGTGGG + Intergenic
914976426 1:152367816-152367838 AAGTGGGTTTGGTGGAGATGTGG - Intergenic
917087572 1:171319185-171319207 CAGTGGGCTTGCTGGGGAGCTGG + Intronic
917710598 1:177680367-177680389 CAGAGTGTTTGGTGGAGAGCAGG - Intergenic
919562651 1:199141141-199141163 TAAAGGGGTTGGTGGTGAGATGG - Intergenic
919741325 1:200983167-200983189 CAGTGTGTGGGGTGGTCAGAGGG + Intronic
919803921 1:201369563-201369585 CCCTGGGTTGGGTGGTGGGAGGG - Intronic
920182343 1:204140026-204140048 CAATGAGTTTGCAGGTGAGAGGG - Exonic
921954250 1:220965780-220965802 GAGTGTGATTGGTGGTGATAAGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922267931 1:224004397-224004419 CAGTTCTTTTGGTGGAGAGATGG - Intergenic
923649858 1:235864342-235864364 GAGTAGGTTTGGTGGGGAGAAGG - Intronic
1063296557 10:4812624-4812646 CAGTGTGTTTGTTGGTGTGGAGG - Intronic
1063599237 10:7464970-7464992 TGGGGGGTTTGGTGGAGAGAGGG - Intergenic
1065086670 10:22185424-22185446 CAGTGGGTTAGGGAGTGAGTGGG - Intergenic
1065087504 10:22194164-22194186 CAGGGACTTTGGTGGTGAGCAGG + Intergenic
1065393432 10:25208501-25208523 CCGTGGTTCTGGTGATGAGATGG - Intronic
1065941307 10:30566551-30566573 CAGTGGAATTGCTGGTGATAGGG + Intergenic
1066725772 10:38391214-38391236 CAGTTCTTTTGGTGGAGAGATGG + Intergenic
1067478134 10:46579377-46579399 CACTGGGTGGGGTGGTGAGAAGG - Intronic
1067616606 10:47762410-47762432 CACTGGGTGGGGTGGTGAGAAGG + Intergenic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1072435891 10:95414563-95414585 CAGCGGAGGTGGTGGTGAGAAGG + Exonic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1073256719 10:102156784-102156806 CAGGGGGTTAGATGGTTAGATGG + Intronic
1073735080 10:106336284-106336306 CAGTGGGTTGGATGGTGAGCTGG - Intergenic
1074083085 10:110183220-110183242 CAGTGTGTGTGTTGGGGAGAAGG + Intergenic
1074243079 10:111658398-111658420 AAATGGGTTTGGTGGTGAGAAGG - Intergenic
1075138228 10:119806751-119806773 GGGTGGGCTTGGAGGTGAGAGGG - Intronic
1075533897 10:123254530-123254552 CAGTGGTGGTGGTGGTGTGATGG - Intergenic
1075533940 10:123254790-123254812 CAGTGGTGGTGGTGGTGTGATGG - Intergenic
1076188070 10:128464282-128464304 AGGAGGGTTTGGTGGAGAGAAGG + Intergenic
1076909107 10:133378759-133378781 CAGTGGGTCTGGGGGTGCCACGG - Intergenic
1077131831 11:976864-976886 TGGTGGTTTTGGTGGTGAGAAGG + Intronic
1077712444 11:4550847-4550869 CAGTGGGATGGGTGGGGAGCTGG - Intergenic
1077865514 11:6218318-6218340 CAGTGGTGATGGTGGTGAGTGGG - Intronic
1078602115 11:12742422-12742444 CAGAGGTTTTGGGGGTGAGAGGG + Intronic
1079608925 11:22406117-22406139 CAGTGGGTGGGGTAGTGGGAGGG + Intergenic
1079865566 11:25729414-25729436 CATTGGGTTTGGTGTGGAAATGG - Intergenic
1081132275 11:39394745-39394767 CTGTGGGATCGGTGGTGAGGTGG + Intergenic
1081548217 11:44087662-44087684 CAGTGTATGTGGTGGGGAGAGGG + Intergenic
1083719516 11:64597525-64597547 CAGTGGACTTGGTGGGGGGATGG - Intronic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084674691 11:70627288-70627310 CAGTGTGGTGGGTGGTGAGTTGG - Intronic
1084914021 11:72414279-72414301 CAGCAGCTGTGGTGGTGAGAAGG + Intronic
1086559077 11:88146206-88146228 CAGTGGGGTCAGTGGTAAGATGG + Intronic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089624912 11:119745233-119745255 AAGGGAGGTTGGTGGTGAGAAGG + Intergenic
1090196623 11:124822045-124822067 CAGTTGTTTTGTTGGGGAGAGGG + Intergenic
1090463208 11:126910314-126910336 CAGTGGGCTGGCTGGAGAGAAGG + Intronic
1090479086 11:127052007-127052029 GAGAGAGTTTGGTGGTGGGAAGG - Intergenic
1091840115 12:3614715-3614737 CAGCGGGCATGGTGCTGAGAGGG + Intronic
1092280843 12:7096708-7096730 CAGTGGGTTTGGCATGGAGATGG - Exonic
1093902406 12:24651042-24651064 AAGTGGGTGGGGTGGTGAGGGGG - Intergenic
1096351104 12:50902149-50902171 CAGAGGGTTTGGTTGCAAGATGG - Intergenic
1096806800 12:54145852-54145874 CAGTTGGTTTGGTGTGGAGAAGG - Intergenic
1097386221 12:58952695-58952717 CAGTGGGTGGGGTAGTGAGTGGG + Intergenic
1097932445 12:65204323-65204345 CAGAGGGTTGGGTGGGGTGAGGG - Intronic
1099312453 12:81044506-81044528 AAGTGGATTTGAGGGTGAGATGG - Intronic
1102098133 12:110256827-110256849 CAGTGTGGTTGCGGGTGAGAGGG - Intergenic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1104204141 12:126620140-126620162 AAGTGGGTGTGGGGGTGAGGGGG + Intergenic
1104715919 12:131016114-131016136 CAGAGGGCTTGGAGGAGAGAAGG - Intronic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1106146279 13:27052686-27052708 CAGTGGCTTTGGGAGTCAGAGGG + Intergenic
1107611784 13:42121665-42121687 CTATGGGTGTAGTGGTGAGAAGG - Intronic
1107785502 13:43952596-43952618 CAGTTGACTAGGTGGTGAGATGG + Intergenic
1112772200 13:102803647-102803669 GAGTGAGTTTGGTGGCGAGACGG - Intronic
1113207917 13:107940103-107940125 CAGTGGGTCTGGTGGTGATTTGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114061809 14:19025517-19025539 CAGTGTGTGTGGTGGTGTGACGG - Intergenic
1114100451 14:19374485-19374507 CAGTGTGTGTGGTGGTGTGATGG + Intergenic
1114293523 14:21308551-21308573 CAGTGGGTGAGGTGCTGATATGG + Intronic
1114401336 14:22413643-22413665 CAGTGGGATAGATGCTGAGATGG + Intergenic
1115290259 14:31763193-31763215 CAGTAGCTTTGGTGGTTGGAGGG + Intronic
1115351813 14:32403854-32403876 AAGTGAATTTGGTGGTGAGAAGG - Intronic
1115467231 14:33728780-33728802 CAGTGGGTTTGGTAGTTAAAGGG - Intronic
1115471041 14:33768940-33768962 CACTGGGATTGGTGGTGGTATGG + Intronic
1116396715 14:44455478-44455500 CAGTTGGTCTGGTGTTAAGATGG - Intergenic
1117050798 14:51857691-51857713 GAGATAGTTTGGTGGTGAGAAGG + Intronic
1117904318 14:60568536-60568558 CAGTGGATTTGGTGATTAGGAGG + Intergenic
1118003562 14:61545289-61545311 CACTGGGGCTGGTGGTGGGAAGG - Intronic
1118264301 14:64279812-64279834 AAGTGGGTTGGGTGGTGGGGTGG - Intronic
1119382617 14:74238978-74239000 CAGTGTGTGTGGTGGTAAGCTGG - Intergenic
1120224757 14:81778218-81778240 AAGGGGGTATGGTGGTGAAAGGG - Intergenic
1120471572 14:84932568-84932590 CAGTGTGATTGGAAGTGAGATGG + Intergenic
1120704995 14:87736547-87736569 CAGGGGGTGTGGTGGGGGGAAGG - Intergenic
1122374531 14:101249142-101249164 ACGTGGGTTTGGAGGTGAGGAGG + Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606092 14:102948324-102948346 GGGTGGGTTTGGAGGTGAGGGGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122888593 14:104722604-104722626 CAGTGGGTCTGGGGGTGTCAAGG - Intergenic
1123015468 14:105371904-105371926 CTGTGTGTTGTGTGGTGAGAGGG + Intronic
1124613349 15:31224083-31224105 CAGAGGGTTTGCCCGTGAGAAGG - Intergenic
1124801838 15:32840238-32840260 AAGGGGCTGTGGTGGTGAGAGGG + Intronic
1125842390 15:42815704-42815726 CAAAAGGTTTGGTGGGGAGAGGG + Intronic
1126357424 15:47811354-47811376 CAGGGAGTTGGGTGCTGAGAAGG - Intergenic
1127128303 15:55835175-55835197 CAGTGGGTTGAGGGGTTAGATGG - Intronic
1129256889 15:74338850-74338872 GAGTGGGAGTGGTGGTGAGAGGG - Intronic
1129697355 15:77748184-77748206 CAGAGAGTGTGGTGCTGAGAAGG - Intronic
1131147860 15:90026450-90026472 CAGTGTCTTTGGTGGGTAGAGGG - Intronic
1131878668 15:96838814-96838836 CAGTGTCCTTGGTGGGGAGAGGG + Intergenic
1132008437 15:98252559-98252581 CAGTGGGCTTGGAGGTGTGAAGG - Intergenic
1132389500 15:101428117-101428139 GAGTGGGGTTGGTGATGAGAGGG - Intronic
1133036812 16:3038198-3038220 CAGGGGCTTTGGTGTGGAGATGG + Intergenic
1133348853 16:5088556-5088578 TAGTGTCTTTGTTGGTGAGATGG + Intronic
1134043024 16:11082532-11082554 CAGTGGGTTTACTGGTGAATTGG + Intronic
1134551840 16:15142241-15142263 CAGTGGGATGGGTGGGGAGCGGG - Intergenic
1134684172 16:16147136-16147158 CAGTGGCTTTGCTGGTGTCAGGG - Intergenic
1135169166 16:20167967-20167989 CAGTGTGTGTTGTGGTAAGATGG + Intergenic
1135258990 16:20964949-20964971 CAGTGGTCTTGGGGGAGAGAAGG - Exonic
1137449788 16:48560942-48560964 CAGTGGCATTGGTGGAGAAAGGG + Exonic
1137627825 16:49920787-49920809 CAGTGGGTCTTGTGCTGAGAAGG + Intergenic
1137694433 16:50452056-50452078 TAGTGGAGTTGGTGGTGGGATGG + Intergenic
1137825454 16:51490546-51490568 CAGTGAGTTTGATGGAGACAGGG + Intergenic
1137979625 16:53058581-53058603 CAGGGAGTGTGGTGGTGAAAGGG + Intronic
1138184261 16:54964131-54964153 CAGTGGGTGTGCTGGGGAGTGGG + Intergenic
1138471430 16:57241140-57241162 CAGTGGGTTTGGGGATCCGATGG + Intergenic
1138845005 16:60554631-60554653 GCCTGGGCTTGGTGGTGAGATGG + Intergenic
1138851312 16:60633062-60633084 CAGTCTGATTGGTTGTGAGAGGG + Intergenic
1139214125 16:65110702-65110724 CAGGGGATTTGGTGCTGAGTTGG + Intronic
1139917431 16:70437432-70437454 CAGTGGGTTGGGTGGAGGAAAGG - Intronic
1140341074 16:74162847-74162869 CTGTGTGTGTGGTTGTGAGAGGG + Intergenic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141285788 16:82670356-82670378 CAGTGGGGAAGGTGGAGAGAAGG - Intronic
1141406567 16:83799353-83799375 CAGTTGGTTTGGTAGTGAATGGG - Intronic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142969394 17:3601120-3601142 CACCGGGTTTGGTGGCCAGAAGG - Intergenic
1143097076 17:4483836-4483858 CAGGGGGTTTGGTGGTGGGCAGG - Intronic
1143273110 17:5690093-5690115 CAGTGGGGTTGGGGGTTGGATGG + Intergenic
1143574222 17:7780577-7780599 CAGAGGGATTTGTGGGGAGATGG + Intronic
1143614652 17:8042620-8042642 CTGTGGGATTGGTAGTGGGAAGG - Intronic
1143644249 17:8219737-8219759 CTGTGTGGATGGTGGTGAGATGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1147169309 17:38608869-38608891 CAGTGTATTTGGTGGGGAGGGGG + Intergenic
1147229729 17:39008704-39008726 AAGTGGGTTTGCTATTGAGAGGG + Intergenic
1147370114 17:39986757-39986779 CAAGGGGTTTGGCGGGGAGATGG + Intronic
1149440906 17:56673138-56673160 CAGTGGGTTTGGTGTCTAGTAGG + Intergenic
1149848659 17:60022115-60022137 GGGTGGGTTTGGGGGTGGGAAGG - Intergenic
1149861510 17:60124409-60124431 GGGTGGGTTTGGGGGTGGGAAGG + Intergenic
1150037659 17:61821209-61821231 CAGTCTGATTGGTTGTGAGAGGG + Intronic
1151970761 17:77456362-77456384 CACTAGGCTTTGTGGTGAGAGGG + Intronic
1152325633 17:79634261-79634283 CAGTGGCTCTGGCGGTGAGGTGG - Intergenic
1152799313 17:82323561-82323583 GAGTGGGTTTGGTGACTAGAGGG + Intronic
1153931435 18:9883080-9883102 CAATGGGTTTTGGGGTGGGATGG + Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155736287 18:29226608-29226630 AGGTGGGTTTGGTGGTGGGGGGG - Intergenic
1155800949 18:30102539-30102561 CAGTGGGTTGGATGGGGAGCCGG - Intergenic
1155936865 18:31763587-31763609 CAGTGGTTTGGGTGGTGGGCGGG - Intergenic
1158408757 18:57186260-57186282 CAGTGGCTTTGCTGTGGAGATGG + Intergenic
1159997551 18:74980887-74980909 CAGTGTGTCTGGGGCTGAGAAGG - Intronic
1161779613 19:6282744-6282766 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
1162321105 19:9970939-9970961 CAGAGGGTGTGGTGCTGAGGCGG - Intronic
1162721174 19:12663878-12663900 AGGGGAGTTTGGTGGTGAGAGGG - Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163608465 19:18288585-18288607 CAGAGGGTTTGGGGATCAGAAGG + Intergenic
1163618104 19:18341357-18341379 CAGTTGGTTTGGGGGTGGGGGGG - Intronic
1164017695 19:21267268-21267290 CAGTAGGTTTGTTTGTGAGTGGG + Intronic
1164774480 19:30842338-30842360 CAAGGGGCTTGGTGGTGAGCCGG - Intergenic
1166380459 19:42352829-42352851 CAGTGGCTTTGATGGTGTCATGG + Intronic
1166455613 19:42937655-42937677 CTGTGTGTTTCCTGGTGAGAGGG + Intronic
1167794710 19:51702057-51702079 GAGTGGGTTTCGTTTTGAGATGG - Intergenic
1168481915 19:56727328-56727350 CAGGGGCTTTGGAAGTGAGATGG - Intergenic
925082158 2:1078817-1078839 CAGGGGATTTGCTGGTGAGTTGG + Intronic
926108540 2:10167573-10167595 CAGCGGGCGTGGTGGTGGGAAGG + Intronic
926116330 2:10215771-10215793 CAGTGGGTTTTGTGGTCTGTGGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929877470 2:45808631-45808653 CACTGGGTTGGGTGGTGGGAGGG + Intronic
930570820 2:53084626-53084648 CTGGGGATTTGGTGGTGGGAAGG + Intergenic
931066812 2:58596834-58596856 CAGAGGCTTTGGGGGTCAGATGG + Intergenic
931259214 2:60602407-60602429 CACTAGGTTCGGAGGTGAGAAGG - Intergenic
931394210 2:61871434-61871456 CAGTGGTTTTACAGGTGAGAAGG - Intronic
932280056 2:70483035-70483057 CAGTTGGCTAGTTGGTGAGAAGG - Intronic
932369628 2:71176439-71176461 CAGTATGTGTTGTGGTGAGAGGG - Intergenic
932495571 2:72144312-72144334 GAGTGTGTTTGGTGGGGAGAGGG - Intronic
932606550 2:73169503-73169525 CAGGAGGTCTGGTGGGGAGAGGG + Intergenic
933702279 2:85263936-85263958 CATTGGGTTTGGTAGTTAGGAGG + Intronic
933925876 2:87090932-87090954 CAGGAGGTCTGGTGGGGAGAGGG - Intergenic
935804461 2:106732190-106732212 CAGGGTGTTTGCTGGTGTGAGGG + Intergenic
935818235 2:106867895-106867917 CAGTGGCTTTTGTGGGGGGAGGG - Intronic
935826808 2:106960427-106960449 CAGTGGGTGTGGTGGTGCTGAGG + Intergenic
937362555 2:121239169-121239191 CACTGAGTGTGGGGGTGAGAGGG - Intronic
937857691 2:126684468-126684490 TAGTGGGCATGGTGGTGGGAGGG - Intronic
937968167 2:127530379-127530401 CAGTGGGGTCAGTGGTGAGGTGG + Intergenic
938894721 2:135738591-135738613 CAGTGAGTGTGAAGGTGAGAAGG - Intergenic
938992522 2:136643913-136643935 CATGGCCTTTGGTGGTGAGAAGG + Intergenic
939216940 2:139250648-139250670 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
939242865 2:139584263-139584285 CACTGGGGGTGGTGGTGAGTGGG - Intergenic
939639029 2:144617205-144617227 CAGGGGGTGTGGTGGGGGGAGGG - Intergenic
944284956 2:197939045-197939067 TAATGGGGGTGGTGGTGAGAAGG + Intronic
944423810 2:199558224-199558246 CTCTGTGTTTGGTGGTGAGTGGG + Intergenic
944851108 2:203720154-203720176 GAGTGAGATTGGAGGTGAGAAGG - Intronic
944968039 2:204958758-204958780 GAGTGTTTTTGGGGGTGAGAAGG - Intronic
945846255 2:214948516-214948538 CAGTGGGTGTGGTGGGGTGGGGG + Intronic
946044441 2:216809982-216810004 CAGTGTGTGGGGTGGTGACATGG + Intergenic
946816889 2:223588034-223588056 CAGTGGGTTTGGGGGCTGGAAGG - Intergenic
947105893 2:226667605-226667627 TAGTGGCTTTGGTGGAGAAAAGG + Intergenic
947725182 2:232393715-232393737 CACTGGGTTTGCGGGTCAGATGG + Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
1168911011 20:1446719-1446741 CAGGTGGTTTGGAGGAGAGAAGG - Intronic
1169169604 20:3454208-3454230 CAGTGGTTATGGGGGTGAGGAGG - Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1174560436 20:51427191-51427213 TGGTGGGTTTGGTGGTGAGATGG + Intronic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175793959 20:61759810-61759832 CAGTGGGGTTGCTCGTGAGTTGG + Intronic
1177041433 21:16116243-16116265 AAGTGAGTTTGGTGGTGTGGAGG + Intergenic
1177445955 21:21196647-21196669 TAGTGAGTGTGGTGGTGATATGG + Intronic
1178668367 21:34568471-34568493 AAGTGTGTTTGTTGGCGAGATGG + Intronic
1178807557 21:35852015-35852037 CAGTGGATTTGGTGGCGGTAGGG - Intronic
1180480297 22:15748131-15748153 CAGTGTGTGTGGTGGTGTGATGG - Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181467402 22:23117595-23117617 CAGTGGGTGTGGCGTGGAGAGGG + Intronic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182527592 22:30931054-30931076 CAGTGGGCTTGGGGGTGAAAGGG - Intronic
1182980108 22:34661820-34661842 CAGTGGGTATGGTGTGGGGAAGG - Intergenic
1184509649 22:44926075-44926097 AAGTGGGTTCTGTGGTGGGAAGG + Intronic
1185169030 22:49281475-49281497 GAGTGGGCTTGGTGGTCTGAGGG + Intergenic
949151591 3:774620-774642 CTGTGTGTTTGGAGGTGATAGGG - Intergenic
949773107 3:7600354-7600376 CAGGGGTTGAGGTGGTGAGATGG + Intronic
952302560 3:32116517-32116539 CAGAGAGTTTTGTGTTGAGAAGG + Intronic
952509932 3:34042781-34042803 CAGTGATTTTGGTAATGAGATGG + Intergenic
952556891 3:34541830-34541852 CAGAGCGTTTGTTGGTGACAAGG + Intergenic
952657999 3:35809438-35809460 CAGGGGATGTGGTGGTGAGAAGG - Intergenic
952850028 3:37720203-37720225 AAGGGGGTTTGCAGGTGAGAAGG + Intronic
952961152 3:38589859-38589881 CAGCTGTTTTGGTGGTGAGATGG + Intronic
953754670 3:45636026-45636048 CACTGGATTTGGTGGTGGGCTGG + Intronic
953921764 3:46956807-46956829 GGGTGGGTGTGGTGGTGACAGGG - Intronic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
954593732 3:51806216-51806238 GAGTGGGAGAGGTGGTGAGAAGG + Intergenic
955017586 3:55087340-55087362 CAGTAGGTTTTGTGGGAAGATGG - Intergenic
957133364 3:76251486-76251508 CACTTGGTTTGGTGGTAAAATGG + Intronic
958028902 3:88083084-88083106 CAGTAGGATTGGTGGTGAGGAGG - Intronic
959459296 3:106604750-106604772 CAGTGGGTTTGGTTTCAAGATGG + Intergenic
959510810 3:107209594-107209616 TAATGGGTTTGGTGGTGACAGGG - Intergenic
959997595 3:112695848-112695870 CAGTGTTTTTGGTGGGGAGGAGG - Intergenic
960882156 3:122356034-122356056 CAGTGAGGTTGGAGGTGAGCAGG + Intergenic
962361748 3:134748888-134748910 CAGTGGGTTCTGTGGGCAGATGG + Intronic
962850370 3:139303907-139303929 GAGCTGGATTGGTGGTGAGATGG + Intronic
963016487 3:140828753-140828775 CAGTAGGTTTGATGGAGTGATGG - Intergenic
964751577 3:160058688-160058710 GAGTGGGGTTGGTGGGGAGTGGG + Intergenic
966665924 3:182471058-182471080 CACTGGGAATGATGGTGAGAGGG - Intergenic
966958488 3:184909107-184909129 CAGTGGGTTTGATAGCGACAGGG - Intronic
967613607 3:191538105-191538127 CAGCGGGGATAGTGGTGAGATGG + Intergenic
968139192 3:196242933-196242955 CAGAGGGTTTGCTGGTGAACCGG + Intronic
968559766 4:1273027-1273049 CAGTGGGTTTTGTTGTTGGATGG + Intergenic
968830997 4:2933025-2933047 CATGGGGTTAGGTGGGGAGAGGG - Intronic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
970052683 4:11932989-11933011 CAGTTGGTTAGGGGGTGGGAGGG + Intergenic
970995301 4:22260551-22260573 CAGTGGTTTTGTTTATGAGATGG - Intergenic
973127148 4:46600865-46600887 TAGTGGGGTTGGTGGAGAGTGGG + Intergenic
975667668 4:76749037-76749059 CAGTGGCTTTGGTCTTGTGAAGG + Exonic
976609784 4:87018499-87018521 AAGTGGTGATGGTGGTGAGAAGG + Intronic
978100514 4:104834738-104834760 GAGGGGGTTGGGAGGTGAGATGG - Intergenic
982011189 4:151107723-151107745 CAGTGTTTTTGGTGGTGGTAGGG + Intronic
982346977 4:154370701-154370723 TAGTGGATTTGGTGGTAGGAAGG + Intronic
982916198 4:161212570-161212592 TAGTGGGATTGCTGGTTAGAAGG + Intergenic
983720955 4:170850738-170850760 CAGTGGGCATGGTGTTGAGGAGG + Intergenic
985842398 5:2317927-2317949 CTGTGGGTTTGGTGGGGCCATGG + Intergenic
987169350 5:15238121-15238143 CAGTGGATTTGGGGGTGACTGGG - Intergenic
989099734 5:37812581-37812603 CAGTGGGCTGTGTGGTAAGAAGG + Intergenic
991168756 5:63595052-63595074 CAGAGGGTGTTGTGGGGAGAAGG + Intergenic
992896344 5:81248413-81248435 AAGTGGGTTTGAGGGTGTGATGG + Intronic
995443791 5:112220711-112220733 CAGAGGGTTGGGAGATGAGAGGG - Intronic
995772357 5:115685255-115685277 CATTGGCTTAGGTGCTGAGATGG + Intergenic
996288901 5:121828757-121828779 CAGGGGGTATGGTTGTGAAATGG + Intergenic
996491107 5:124098386-124098408 CAGTAGGGATAGTGGTGAGAAGG - Intergenic
996533354 5:124549660-124549682 CAGAAGGTGTAGTGGTGAGAAGG + Intergenic
997652676 5:135534173-135534195 CAGAGGCTTTGGAGGTGAGTGGG + Intergenic
997721037 5:136078622-136078644 TATTGGCTTTGGTGGTGGGAAGG + Intergenic
998012830 5:138709068-138709090 CAGTGCTTTTCGTGGGGAGATGG - Intronic
999212796 5:149904983-149905005 AAATGGATTTGGTGGTGAGGTGG - Intronic
999837602 5:155391485-155391507 TATGGGGTCTGGTGGTGAGAGGG - Intergenic
999853159 5:155564768-155564790 CAGTCCGGTTGGTTGTGAGAGGG - Intergenic
1000173275 5:158725293-158725315 CAGTGGGGTGGATGGTGGGAAGG - Intronic
1000205633 5:159055748-159055770 CAATGGATTTGGTGGTGATTTGG + Intronic
1001485209 5:172115097-172115119 CAGTGTGGTGGGTGGGGAGATGG - Intronic
1002075505 5:176705984-176706006 CAGTGGCTTTGGGGGTGGGGTGG - Intergenic
1002653277 5:180720612-180720634 CTGTGGCTTTGTTGGTGAGCGGG - Intergenic
1003297870 6:4849857-4849879 CAGTGTGTTTGATGGTGAGATGG + Intronic
1003377777 6:5595068-5595090 AAGGGGGTTTGGAGCTGAGAGGG + Intronic
1003773539 6:9335036-9335058 CAGTGGGTTTTCTGGTTGGAGGG - Intergenic
1003800067 6:9654063-9654085 CAGTTGATTTTGTGGTGTGAAGG - Intronic
1004478289 6:15994679-15994701 CAGTGGGCTTGGGAGGGAGATGG + Intergenic
1004764465 6:18709936-18709958 CACTGGATGTGGTGGTGATATGG - Intergenic
1005520053 6:26592872-26592894 CCTGGGGTTTGGTGGTGAAATGG + Intergenic
1005602781 6:27444663-27444685 CATTGGATTTGGCAGTGAGAAGG - Intergenic
1006747326 6:36352478-36352500 GACTGGGGTTGGGGGTGAGAGGG - Intergenic
1007598153 6:43064599-43064621 GAGTGGGTTAGGAGTTGAGATGG + Intronic
1007664225 6:43505134-43505156 CAGTGGGTGTGGTGGAGACGGGG - Exonic
1010234918 6:73567284-73567306 CTGTGGGGTAGGTGGTGTGAGGG + Intergenic
1010986598 6:82432390-82432412 CTCTGGGTTTGATGGTAAGAAGG + Intergenic
1012205594 6:96457027-96457049 AAGTGTATTTGGTGGAGAGAAGG + Intergenic
1012981544 6:105835624-105835646 CGGTGGGTTTGGGAGTGAGTGGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014918769 6:127187102-127187124 CAGCGGGCATGGTGGTGAGATGG + Intronic
1015575145 6:134663514-134663536 CACGGGTTTTGATGGTGAGATGG + Intergenic
1017006247 6:150029629-150029651 CAATGGATTTGGGGGTGAGGTGG - Intergenic
1017141196 6:151191548-151191570 CACTGGATTTGGTAATGAGAAGG + Intergenic
1017680668 6:156861169-156861191 CTGTGTGTTTGGTGGTGGGGAGG + Intronic
1018379526 6:163245673-163245695 CAGAGTGTGTGGTGGGGAGAGGG - Intronic
1018849446 6:167576594-167576616 CAGTGGGTTTGGCAGCGAGGCGG - Intergenic
1019036229 6:169062253-169062275 CACTGGGTCTGGTGGTGTGCAGG + Intergenic
1019110314 6:169704192-169704214 CTCTGGATTTTGTGGTGAGAAGG + Exonic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1020086031 7:5311289-5311311 CAGTGGGTTAGCTGTTCAGAAGG - Intronic
1020320263 7:6934627-6934649 CAGTGTCTTTGTCGGTGAGATGG + Intergenic
1020344524 7:7148852-7148874 CAGTGTGTTTGCTGGTGAGTAGG + Intergenic
1021150499 7:17145180-17145202 CAATGGGGTGGGTGGTGGGAAGG - Intergenic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1021776060 7:24056523-24056545 CATTTGGAATGGTGGTGAGAGGG + Intergenic
1021788677 7:24178256-24178278 CAGAGGGTTGGGTGGGGAGGAGG + Intergenic
1022578597 7:31524210-31524232 CAGTGGGGTTGGTAGAGAAAGGG + Intronic
1023006438 7:35874540-35874562 CAGTTCTTTTGGTGGAGAGATGG - Intronic
1023348898 7:39299957-39299979 CAGTGGGCTGGATGCTGAGAAGG - Intronic
1024067889 7:45757274-45757296 CAGTTCTTTTGGTGGAGAGATGG + Intergenic
1025663677 7:63571095-63571117 CAGTGGGTTAGCTGTTCAGAAGG - Intergenic
1025996630 7:66531477-66531499 AAGTGGATTTGGTGGGTAGAGGG - Intergenic
1026684354 7:72495434-72495456 CAGTGGGTTGGGTGCAGAGTAGG - Intergenic
1026988683 7:74570880-74570902 AAGTGGATTTGGTGGGTAGAGGG - Intronic
1027763454 7:82308647-82308669 CAGTGGTTTTGGTGTAGAGAGGG - Intronic
1027917312 7:84341932-84341954 TAATTGGTTTGGAGGTGAGAAGG - Intronic
1028027920 7:85869731-85869753 CTGTGGGGTTAGTGGTGATATGG - Intergenic
1028079954 7:86563149-86563171 AAGAGGGTTTGGTGGTGAGGAGG - Intergenic
1029177378 7:98674661-98674683 AAGTGGGTGGGGTGGGGAGAGGG - Intergenic
1029195037 7:98799445-98799467 CAGTGGGTTGGATAGTGATATGG + Intergenic
1029431446 7:100533551-100533573 CACTGGGTGTGGTGGTGTGAGGG - Intergenic
1031594957 7:123639695-123639717 CAGTGTGTTTGTTTTTGAGATGG + Intergenic
1033222300 7:139536216-139536238 CAGTGGGACTGGCGGTGGGATGG + Intronic
1033300175 7:140177752-140177774 AAATGGGGTTGGTGGAGAGAGGG + Intergenic
1033949822 7:146771109-146771131 CAGGGAGTTTGGGGGTGAGGTGG - Intronic
1034077760 7:148249230-148249252 CAGTGGGTTTGGTGGTGAGAAGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035136121 7:156704303-156704325 CTGTGGGTTTGTTGGTGTTATGG - Intronic
1035299480 7:157887725-157887747 GAGTGGGTATGGTGGGGAGTGGG - Intronic
1035299529 7:157887880-157887902 GAGTGGGTATGGTGGAGAGCAGG - Intronic
1035685298 8:1519798-1519820 CAGTGGGTTTTGTGCTCAGCAGG + Intronic
1035743851 8:1947622-1947644 CAGTGGGTGGGGTGCTGGGATGG - Intronic
1036209047 8:6827249-6827271 CAGTGGGTTTGCTGGGCAGCAGG - Intronic
1036255919 8:7206546-7206568 CAGTGGGTTGGTTGGATAGATGG + Intergenic
1036361568 8:8080953-8080975 CAGTGGGTTGGATGGATAGATGG - Intergenic
1036439250 8:8765758-8765780 CAGTGGGTTTCTGGGGGAGATGG + Intergenic
1036660718 8:10706751-10706773 CAGAGGGGTTGGGGGTGACAGGG - Intronic
1040387622 8:46924228-46924250 CAGAGGGGTGGGTGGTGGGATGG - Intergenic
1040569308 8:48593638-48593660 CAGTGGGCTGGGTGTGGAGAAGG + Intergenic
1040646413 8:49402167-49402189 CGGTGGGGTTGGTGGTGGGCGGG - Intergenic
1041944020 8:63421873-63421895 AAGTGGTAATGGTGGTGAGAGGG - Intergenic
1042066582 8:64883848-64883870 CATTGGGTTTGATGGTTTGAAGG - Intergenic
1042319447 8:67459598-67459620 CATGGGGTTGGGTGGAGAGAGGG + Intronic
1042540903 8:69906231-69906253 AAGTGGGTTTGGAGATGAGTCGG - Intergenic
1042823345 8:72955709-72955731 CACTGGGTGTGGTGCAGAGAGGG + Intergenic
1043261783 8:78209504-78209526 CACTGGGTGTGGTAGGGAGAGGG + Intergenic
1043398192 8:79858493-79858515 CAGTGGATTTGGGGAGGAGAAGG - Intergenic
1043815103 8:84792268-84792290 CAGTGGGATGGATGGGGAGATGG + Intronic
1043941097 8:86196817-86196839 CATTGGCTTTGGGGGTGGGAAGG + Intergenic
1044360124 8:91273187-91273209 TGGAGGGGTTGGTGGTGAGAGGG + Intronic
1047054367 8:121147602-121147624 CAGTGGTTTTGTGGGTGAGCTGG - Intergenic
1049298742 8:141857728-141857750 CACTGGGTTAGGTGGTGTGCCGG - Intergenic
1049401330 8:142428780-142428802 CAGTGGGCTGTGTGGGGAGATGG + Intergenic
1049453662 8:142676147-142676169 CAGTGGGGTGGGTGGGCAGAAGG + Intronic
1049748834 8:144274125-144274147 CAGTGGCTGTGATGCTGAGAAGG - Intronic
1050308156 9:4327148-4327170 CAGTTGGTGTAGAGGTGAGAAGG + Intronic
1052014029 9:23444242-23444264 CAGTGTGTTTGATAATGAGAAGG - Intergenic
1052853153 9:33390374-33390396 TAATGGGTCTGGTGGTGAGAGGG + Intronic
1052866615 9:33468009-33468031 CAGTGAGTTTAGGGGTGACAGGG - Exonic
1052885917 9:33647919-33647941 CAGTGGGTTGGATGGGGAGCTGG - Intergenic
1052997257 9:34557792-34557814 CAGAGGGCATGGTGGTGGGATGG + Intronic
1053112185 9:35470861-35470883 CAATGGGTTGGCTGGTGGGAAGG + Intergenic
1053181958 9:35980306-35980328 CAGTGGCTTGGGTGGTGAACGGG + Intergenic
1053681191 9:40486548-40486570 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1053931180 9:43114872-43114894 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054282523 9:63138386-63138408 TAATGGGTCTGGTGGTAAGAGGG - Intergenic
1054392300 9:64626552-64626574 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054426948 9:65131763-65131785 TAATGGGTCTGGTGGTAAGAGGG + Intergenic
1054503427 9:65889777-65889799 TAATGGGTCTGGTGGTAAGAGGG - Intronic
1055510563 9:76992076-76992098 CACTGGGTCTGGCGGTGTGAAGG - Intergenic
1056825454 9:89873603-89873625 CAGGGTTTGTGGTGGTGAGAGGG - Intergenic
1056858409 9:90156362-90156384 CAGTGGGTATGATGGGGAGGAGG + Intergenic
1057270543 9:93648170-93648192 CTGTTGGTTTGTTGGAGAGAAGG + Intronic
1057319291 9:93997523-93997545 CAGTGATTTTGGTTATGAGAGGG - Intergenic
1058590316 9:106558252-106558274 CAGTGGGTTCATTGGTGGGATGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1060697085 9:125718565-125718587 CAGAGGTATTGGTGGGGAGAGGG + Intergenic
1061034942 9:128108184-128108206 CAGTGAGTTTGGTTCTGAGGTGG - Exonic
1061845003 9:133382718-133382740 CAGTGGTGTTGATGGTGTGATGG + Intronic
1061845035 9:133382942-133382964 CAGTGGTGTTGATGGTGTGATGG + Intronic
1061850396 9:133411539-133411561 AAGTGGGGTTGGTGGTGGGGTGG - Intronic
1062092011 9:134683276-134683298 CAGAAGGTTTGGAGGTGAGACGG - Intronic
1062093180 9:134689255-134689277 CAGAAGGTTTGGAGGTGAGATGG - Intronic
1062707553 9:137953794-137953816 CAGAGGGTGTTGTGGGGAGAGGG + Intronic
1186122406 X:6377912-6377934 TAGTGGGGGTGGTGGTGAGAGGG + Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1187826358 X:23335523-23335545 CAGTGGGCTTGGGGGTGGGGAGG + Intronic
1188048402 X:25454491-25454513 CTGTGTGTTTGGTGAGGAGATGG - Intergenic
1190334443 X:49253805-49253827 CAGTGGTGGTGGTGGTGGGAAGG + Intronic
1191882139 X:65853457-65853479 CTGTGGGATCGGTGGTGATATGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1194208589 X:91040488-91040510 CAGTGGGTGTAGTGGACAGAGGG - Intergenic
1195783118 X:108485838-108485860 CAGTGGATTTGGGGGTGGGGAGG - Intronic
1198216512 X:134560273-134560295 TAGTGGGGTGGGTGGTGGGAGGG - Intergenic
1198869992 X:141168017-141168039 GAATGGGTTTGGTGATCAGAAGG - Intergenic