ID: 1034079282

View in Genome Browser
Species Human (GRCh38)
Location 7:148261608-148261630
Sequence TGGAGCTGGTCCGGAATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034079278_1034079282 -8 Left 1034079278 7:148261593-148261615 CCTGCTTAGCCAAGCTGGAGCTG 0: 1
1: 0
2: 0
3: 24
4: 188
Right 1034079282 7:148261608-148261630 TGGAGCTGGTCCGGAATTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
1034079277_1034079282 -7 Left 1034079277 7:148261592-148261614 CCCTGCTTAGCCAAGCTGGAGCT 0: 1
1: 0
2: 1
3: 16
4: 151
Right 1034079282 7:148261608-148261630 TGGAGCTGGTCCGGAATTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
1034079274_1034079282 12 Left 1034079274 7:148261573-148261595 CCTGGCAGAGAGCAGAGACCCCT 0: 1
1: 0
2: 3
3: 43
4: 360
Right 1034079282 7:148261608-148261630 TGGAGCTGGTCCGGAATTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109
1034079276_1034079282 -6 Left 1034079276 7:148261591-148261613 CCCCTGCTTAGCCAAGCTGGAGC 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1034079282 7:148261608-148261630 TGGAGCTGGTCCGGAATTGCTGG 0: 1
1: 0
2: 1
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034079282 Original CRISPR TGGAGCTGGTCCGGAATTGC TGG Intronic
900458820 1:2790406-2790428 TGGACCTGGTGGGGACTTGCAGG - Intronic
901490305 1:9593302-9593324 GGGAGCTGGGCATGAATTGCAGG - Intronic
901860969 1:12074069-12074091 TGGAGCCGGCACGGGATTGCTGG + Intronic
907405632 1:54251887-54251909 AGGAGCTGCTCCGGAGCTGCTGG + Intronic
907766375 1:57415748-57415770 TGGTGCTTGTCTTGAATTGCAGG - Intronic
908433708 1:64083862-64083884 TGGAGATGATCAGGAATGGCTGG + Intronic
909443020 1:75718676-75718698 TGGAACTGGTGAGGAGTTGCTGG + Intergenic
909599502 1:77447143-77447165 TGGAGATAGCCAGGAATTGCTGG - Intronic
910844843 1:91594993-91595015 TGGGGGAGGTCAGGAATTGCCGG - Intergenic
915355202 1:155251666-155251688 TGGGGCTGGGCCTGGATTGCTGG - Intronic
920246075 1:204588741-204588763 TGGAACTGAGCCGGAACTGCTGG - Intergenic
920390152 1:205594949-205594971 TGCAACTGGTCCGGAGCTGCTGG + Intronic
921448041 1:215269922-215269944 TGGAGCTGATCTGCAAGTGCGGG + Intergenic
924878187 1:248128670-248128692 TGGAGCTGGTGCTGAGTTGCAGG + Intergenic
1067499825 10:46793357-46793379 TTGAGCTGGTCCAGTGTTGCTGG + Intergenic
1067594806 10:47546968-47546990 TTGAGCTGGTCCAGTGTTGCTGG - Intronic
1067641914 10:48055078-48055100 TTGAGCTGGTCCAGTGTTGCTGG - Intergenic
1069815908 10:71194170-71194192 GAGAGCTGGACTGGAATTGCTGG + Intergenic
1071606581 10:86997327-86997349 TTGAGCTGGTCCAGTGTTGCTGG + Intergenic
1072421345 10:95292206-95292228 TGGGGCTGGTCTAGAATTCCTGG - Intergenic
1075904839 10:126072203-126072225 TGGAGGTGATCCAGAAATGCAGG + Intronic
1076885097 10:133258559-133258581 TGGGGCTGGGCAGGAAGTGCTGG - Intergenic
1085737665 11:79053467-79053489 AGGAGATGGTTCTGAATTGCTGG - Intronic
1088196338 11:107278162-107278184 TGGAGCTTGTCTGGATTTGCTGG + Intergenic
1091293318 11:134454614-134454636 TGGAGCTGCTCAGCAAGTGCTGG + Intergenic
1091669840 12:2445127-2445149 TGGAGGGGGTCAGGCATTGCAGG - Intronic
1094190040 12:27688795-27688817 TAGAGCTGGTCCTGAAATCCAGG - Intronic
1096898491 12:54849982-54850004 TGAAGCTGGTCTGCAGTTGCTGG - Intronic
1097960996 12:65531834-65531856 TAGAGCTGGTCAGGAACAGCTGG - Intergenic
1107155507 13:37162549-37162571 TTGAGCTGGTTCGGAAAAGCAGG + Intergenic
1110457491 13:75706147-75706169 TGTAGCTTGTTCAGAATTGCAGG + Intronic
1114051345 14:18921406-18921428 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1114111217 14:19480519-19480541 TGCAGCTGGCCAGAAATTGCTGG + Intergenic
1117132835 14:52703331-52703353 TTCAGCTGCTCCTGAATTGCTGG - Intergenic
1119314047 14:73676348-73676370 TGGAGCTGGTAGGGAATAGGAGG - Intronic
1125814725 15:42575166-42575188 TGAAGCTGGGCCGGCACTGCTGG + Intergenic
1128453332 15:67819756-67819778 TGGAGAGGGTCCGGATTTGGTGG - Intronic
1128696174 15:69764501-69764523 TGGAGCTGGTCTCGAACTCCTGG - Intergenic
1129236527 15:74226935-74226957 TGGAGGTGGTAGGGAGTTGCAGG + Intergenic
1129805181 15:78450471-78450493 TGGAGCTGGTCTGGAGTTGCTGG + Intronic
1130381624 15:83377040-83377062 TGGAGCTGATCGGGAGGTGCTGG - Intergenic
1131161069 15:90105166-90105188 TTGTGCTGGTCTGGAATTCCTGG + Intergenic
1133875097 16:9726596-9726618 TGGAGGTGGTCGGGAATTCCAGG - Intergenic
1134677967 16:16103812-16103834 TGGTTATGGTCCGGAATTGGTGG + Intronic
1137286934 16:47024108-47024130 TCGGGCTGGTCCTGAACTGCTGG - Intergenic
1140430281 16:74897119-74897141 TGGAGCTGGACAGGCATCGCTGG - Intronic
1140996621 16:80266164-80266186 TGGAGCTGGTCCTGATTTTTGGG - Intergenic
1141202772 16:81910535-81910557 TGGAGCGGATCCGGCAGTGCTGG - Exonic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1141583734 16:85019010-85019032 TGGAGCAGGTCTGGAATTGGAGG + Intergenic
1143894900 17:10128150-10128172 TGGAGCCGCCCCGGAACTGCTGG - Intronic
1144018261 17:11217932-11217954 TGGAGCTGGGCTAGGATTGCAGG + Intergenic
1145193340 17:20866921-20866943 TCCAGCTGGCCAGGAATTGCTGG + Intronic
1145298680 17:21614160-21614182 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1145351599 17:22089130-22089152 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145403758 17:22568935-22568957 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1145723168 17:27090896-27090918 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1147217200 17:38907857-38907879 TAGAGCTGGTCAGGGTTTGCAGG + Intronic
1151497295 17:74466537-74466559 TGGAGCCGGTCAGAAAATGCAGG - Exonic
1153234981 18:2977273-2977295 TGGTGCTGGACTGGAATTGGAGG + Intronic
1153605721 18:6829292-6829314 TGGAGCTGGACTGAAATTGGAGG - Intronic
1155939019 18:31785004-31785026 CGGAGCTGGTCCTGAGTTCCAGG - Intergenic
1156407486 18:36796773-36796795 TGGAGCTGGTAGGGAGTTGGAGG + Intronic
1161391610 19:4024099-4024121 TGGAGTTGATCCGGAACTCCAGG + Exonic
1162125216 19:8495944-8495966 TGGAGCTGGGCAGGAGGTGCGGG + Intronic
1165839463 19:38779145-38779167 TGGAGCTGGACTGGAAGTGGAGG + Intergenic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1167031691 19:46966337-46966359 TGGGGCTGGTCTTGAATTCCTGG - Intronic
1167168159 19:47813455-47813477 GGGAGTTGTTCCAGAATTGCAGG + Intronic
1167220772 19:48196784-48196806 TGGACCTGCTCAGGGATTGCTGG + Intronic
925359650 2:3268388-3268410 TGGAGCTGGTCCACAGTCGCTGG - Intronic
926713837 2:15907897-15907919 TGAAGCTGGTCTGGAACTCCTGG - Intergenic
932758400 2:74424276-74424298 TGGAGCTGGGCCTGAATAGGTGG - Intronic
934775620 2:96935393-96935415 TGGAGCTGAGCCGTAATAGCTGG - Intronic
935386248 2:102502645-102502667 TGGAGTTGGTCTGGAGTTGGTGG + Intronic
936614878 2:114038515-114038537 TGAGGCTGGTCTTGAATTGCTGG + Intergenic
938032624 2:128008578-128008600 TGGGGCTGGTCTTGAATTCCTGG + Intronic
944815184 2:203369043-203369065 TGGGGCTGGTCCTGAAATCCTGG + Intronic
1168999388 20:2156117-2156139 TGGAGCTGGCCTGGAGCTGCTGG - Intronic
1171418571 20:25000736-25000758 TGAAACTGGTGTGGAATTGCTGG + Intergenic
1175637221 20:60595943-60595965 TGTAGCTGGTCCAGGATTCCAGG - Intergenic
1179346272 21:40560378-40560400 TAGAGCTGGCCAGGAATTTCCGG - Intronic
1179596629 21:42446990-42447012 TGGAGCTAGTCTGAAATTGATGG + Intronic
1180469818 22:15643781-15643803 TGCAGCTGGCCAGAAATTGCTGG - Intergenic
1180655452 22:17416709-17416731 CCGAGCTGGTCTGGAACTGCTGG + Intronic
1180961342 22:19763708-19763730 TGGAGCTGGGCCGGAAAGGTGGG + Intronic
1181873901 22:25924872-25924894 TGGAGCTGATTTGGAATTGATGG + Intronic
1181979861 22:26758748-26758770 AGGAGCTGGTCAGGACTTGGTGG + Intergenic
1182643267 22:31786343-31786365 TGGGGCTGGTCTGCAATTCCAGG - Intronic
949934929 3:9109267-9109289 TGGAACTGATGGGGAATTGCTGG + Intronic
952463832 3:33559144-33559166 TGAAGCTGGTCCCGAAGTGCTGG + Intronic
957764193 3:84600397-84600419 TGGAACTGGTCCAGAACTACTGG + Intergenic
970205848 4:13654728-13654750 TGGAGCCGGCCTGGAATTGCTGG - Intergenic
977376485 4:96211774-96211796 TGGAGCTGGAGCAGATTTGCGGG + Intergenic
981351835 4:143739165-143739187 TGAAGCTGGTCCCCAATTCCTGG + Intergenic
983374979 4:166915010-166915032 TGATGCTGGTCAGGATTTGCTGG + Intronic
993798966 5:92305486-92305508 TGGAACTGCTCCTGAATTGCTGG - Intergenic
996486508 5:124041836-124041858 TGGAGCTGATACGAAAGTGCTGG + Intergenic
1001925058 5:175630181-175630203 TGGAGATGGTGAGGAATGGCAGG - Intergenic
1002541534 5:179909008-179909030 TGGAGCTGGACCTGACTTCCAGG + Intergenic
1006491761 6:34393617-34393639 CCGGGCTGGTCCGGAATTCCTGG + Intronic
1009591126 6:65672493-65672515 TGGAGCTGGTCCACAAATACTGG + Intronic
1016305572 6:142680197-142680219 TGGAGCTGCTTTGGAATGGCTGG - Intergenic
1021611300 7:22460477-22460499 TGGAGCTCATCTGGAGTTGCTGG + Intronic
1025275970 7:57581278-57581300 TCCAGCTGGCCAGGAATTGCTGG - Intergenic
1034079282 7:148261608-148261630 TGGAGCTGGTCCGGAATTGCTGG + Intronic
1034726780 7:153343535-153343557 TGGTGCTGGACTGGAATTGAAGG + Intergenic
1038275863 8:26120169-26120191 TGAAGCTGGTCTGAAATTGTGGG - Intergenic
1040571970 8:48619448-48619470 TGGAGCTGGTCATGATGTGCAGG - Intergenic
1046081938 8:109379895-109379917 AGGAGCTGGTCTGGAATTCAGGG + Intronic
1056129725 9:83572280-83572302 TGGAAATGGTAGGGAATTGCTGG + Intergenic
1057379155 9:94553550-94553572 TCCAGCTGGCCAGGAATTGCTGG + Intergenic
1057706006 9:97395629-97395651 TGGAGCAGGTCTGGAAGGGCAGG + Intergenic
1186300190 X:8192278-8192300 TAGTGCTGGTCTGGAATAGCAGG + Intergenic
1188451026 X:30308491-30308513 TGGTGCTGGTGCGCAACTGCTGG - Exonic
1189632546 X:42970096-42970118 TGGAGCAGGGCAGGATTTGCAGG + Intergenic
1197984305 X:132251112-132251134 TGGAGAAGGTCAGAAATTGCAGG + Intergenic
1200380179 X:155828998-155829020 TAGAACTGGTCCGTAACTGCTGG + Intergenic