ID: 1034080557

View in Genome Browser
Species Human (GRCh38)
Location 7:148274181-148274203
Sequence CTGTAGTCACAGAGGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034080557 Original CRISPR CTGTAGTCACAGAGGGACCC AGG (reversed) Intronic
900746664 1:4365537-4365559 CTGGAGTCACATGGTGACCCGGG + Intergenic
901142944 1:7047129-7047151 ATGTAGTCACTCAGGGATCCAGG - Intronic
903340579 1:22651866-22651888 CTATAGTCCCGAAGGGACCCAGG - Intergenic
904578222 1:31519969-31519991 ATGTAGTCATTCAGGGACCCAGG - Intergenic
906003774 1:42450296-42450318 CTGAAGTCACACAGGGATGCTGG + Intronic
907710229 1:56874020-56874042 CTGCAGTCAAAGGTGGACCCAGG + Intronic
908457060 1:64314125-64314147 CTGTAGTCACAGGCAGTCCCAGG - Intergenic
909371169 1:74885057-74885079 CTGCACACACACAGGGACCCTGG - Intergenic
910281552 1:85506911-85506933 CAGTAGTCAGAGAGTGACCACGG + Intronic
913322124 1:117596049-117596071 CAGGAGTCTCATAGGGACCCCGG - Intergenic
913483212 1:119309526-119309548 TTGTAATCACATAGGCACCCAGG - Intergenic
913483453 1:119311726-119311748 TTGTAGTCCCTCAGGGACCCAGG - Intergenic
916094676 1:161338804-161338826 CTGGAGAAATAGAGGGACCCAGG + Intronic
916474551 1:165156384-165156406 GTGTAGTCACTCAGGGAGCCAGG + Intergenic
916677221 1:167074231-167074253 CTGGAGTCACAGGTGCACCCAGG - Intronic
918852386 1:189708775-189708797 CTGTAGCCAGACAGGAACCCTGG - Intergenic
919762197 1:201105251-201105273 CTATAGTCACAGAGACCCCCAGG - Intronic
920034347 1:203056249-203056271 CTGAACTCAGAGAGGCACCCAGG + Intronic
920530842 1:206701162-206701184 CTGTATTCTCAGTGGGATCCAGG - Intronic
920533204 1:206720086-206720108 CTGGAGCCAGAGAGGGACACAGG - Intronic
921298404 1:213726206-213726228 CTGTAGTCCCAGATGTGCCCAGG - Intergenic
921442621 1:215205633-215205655 TTGTAGTTACTCAGGGACCCAGG - Intronic
923101303 1:230819909-230819931 CTTCAGTCTCAGAGAGACCCAGG - Intergenic
923543471 1:234906858-234906880 CTGCAGTCACTGAGGCACTCGGG + Intergenic
924879024 1:248137606-248137628 CTGTATTCACCGAGGGATCCTGG - Intergenic
924881504 1:248166089-248166111 CTGTATTTACCGAGGGATCCTGG - Intergenic
924893014 1:248305709-248305731 CTGTATTCACCGAGGGATCCTGG + Intergenic
1063114557 10:3064611-3064633 TTGCAGCCACAGAGGGCCCCTGG + Intergenic
1065722566 10:28640913-28640935 CTCTAGTCAATGAGAGACCCAGG - Intergenic
1067695875 10:48535361-48535383 ATGTGGTCACTCAGGGACCCAGG + Intronic
1069770589 10:70896859-70896881 TTGTAGTTACACAGGAACCCAGG + Intergenic
1070366299 10:75740498-75740520 AGGTGGTCACAGAGGGGCCCTGG - Intronic
1070665490 10:78339557-78339579 CTCAAATCACAGAGGGACCTTGG + Intergenic
1072877605 10:99189900-99189922 CTTTAGTCAGAGAGGGCCCAAGG + Intronic
1073104430 10:101024106-101024128 TTGTGGGCACAGAGGGCCCCTGG + Intronic
1073758004 10:106601716-106601738 CTGTGGTCACACAGGGACACTGG + Intronic
1075554273 10:123418842-123418864 ATATAGTCACTCAGGGACCCAGG + Intergenic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077114141 11:875484-875506 CTGTAGACACTGAGGGCCCCGGG + Intronic
1077239223 11:1501964-1501986 CTGTAGGCACAGAGAGACGGTGG - Intergenic
1078428362 11:11269065-11269087 CTGTAGTCTCAGACAGGCCCTGG - Intergenic
1084916113 11:72430161-72430183 CTGTAGTCACAGAGTCACCTGGG - Intronic
1085416243 11:76320869-76320891 CTGAAGTCACACAGGGACTCCGG + Intergenic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1085931714 11:81091467-81091489 CTGTACACACACAGTGACCCCGG - Intergenic
1088625555 11:111727783-111727805 CTGGAGTCACAGTTGGTCCCAGG + Exonic
1089116500 11:116099391-116099413 GTGTTGCCACAGAGGGTCCCAGG - Intergenic
1091009299 11:131983803-131983825 ATGTAGTCACTCAGGGATCCAGG + Intronic
1091711327 12:2742534-2742556 CTGAAGTGACAGAAGGACCGAGG + Intergenic
1095267345 12:40175687-40175709 ATGAGGTCATAGAGGGACCCAGG + Intergenic
1096603153 12:52744863-52744885 CTGGAGCAACAGAGGTACCCAGG - Intergenic
1098485702 12:71019193-71019215 ATGTAGTCATACAGGGACCCAGG + Intergenic
1099205565 12:79722197-79722219 CCGTAGCCACAGAGGGTCCCAGG - Intergenic
1099985545 12:89658692-89658714 CTTTAGTCACTGATTGACCCAGG - Intronic
1101284367 12:103295190-103295212 TTGTAGTCACACAGGGACACAGG - Intronic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1102900608 12:116633633-116633655 CTGCACTCTCAGAAGGACCCTGG - Intergenic
1102955990 12:117059315-117059337 CCGGGGACACAGAGGGACCCGGG - Intronic
1103035247 12:117651333-117651355 CTCAAGTCCCAGAGGGTCCCTGG + Intronic
1104622505 12:130328628-130328650 GTTTAGTCACACAGGTACCCTGG - Intergenic
1104902660 12:132197712-132197734 CTCTAGTGGCAGAGGCACCCAGG + Intronic
1105025056 12:132842705-132842727 CTGCAGTCACTGAGGGCCTCAGG - Intronic
1107336733 13:39363365-39363387 CTTTAGAGACAGAGGGACCTAGG + Intronic
1108228910 13:48318008-48318030 CTGTCGTCAGACAGGGAGCCGGG + Intronic
1109233619 13:59789233-59789255 CTTTAATCACAGAGTAACCCAGG + Intronic
1109673583 13:65641891-65641913 CTGTAGTCCCAGAGATACTCAGG + Intergenic
1112504249 13:99966048-99966070 CTGCAGTCCCAGAGGGATCAGGG + Intronic
1113778022 13:112960031-112960053 CTGAAGTTACCGAGGGACCTCGG - Intronic
1114696394 14:24631204-24631226 CTCTATTCACAGGGGGACTCTGG - Exonic
1115912610 14:38272970-38272992 CTGTAGTCAGAGAGACACCAAGG + Intergenic
1115982574 14:39070368-39070390 CTGTCGTCACAGAATGACCTGGG - Intronic
1116787289 14:49301609-49301631 CTGAAAACACAGAGGGACTCAGG + Intergenic
1119108467 14:71947200-71947222 CTTTAGCCACAGGGAGACCCAGG - Intronic
1119147653 14:72331559-72331581 CTGCGGTCTCAAAGGGACCCTGG - Intronic
1121442963 14:93960251-93960273 CCTCAGTTACAGAGGGACCCTGG - Intronic
1122129325 14:99596013-99596035 CAGTAATGACAGAGGGCCCCAGG + Intronic
1124638829 15:31382399-31382421 CAAAAGTCACGGAGGGACCCTGG + Intronic
1124713421 15:32033404-32033426 CTCTAATCACAGAGTGACCTTGG - Intronic
1128084764 15:64878103-64878125 CTGGAGGGCCAGAGGGACCCCGG + Intronic
1128157651 15:65401966-65401988 CTATAGTCACTGAGGGGTCCAGG - Intronic
1128212804 15:65914099-65914121 GGGTAGTCACATAGGGACTCAGG - Intronic
1128267507 15:66279601-66279623 CTGTAGGCACTGGGGAACCCTGG - Intergenic
1128480470 15:68033278-68033300 CCATAGTCACTGAGGGACCCAGG + Intergenic
1128502320 15:68235242-68235264 GTGTAGTCACAGGTGGACCTGGG + Intronic
1129389468 15:75213457-75213479 CTGGGGCCACAGAGGAACCCAGG - Intergenic
1129859947 15:78853007-78853029 CTGGAGTCACAGAGTGACTAGGG - Intronic
1130882818 15:88069808-88069830 CTGAACTCACAGAGGGAAGCTGG + Intronic
1134309886 16:13066192-13066214 CTGTAGTCACGCAGGGACCCAGG - Intronic
1137551417 16:49440156-49440178 CTGTAGGGAGAGAGGGACTCAGG - Intergenic
1138552729 16:57756317-57756339 ATGAAGTCACAGATGGACCAAGG - Intronic
1138629302 16:58280747-58280769 CTTTTATCACAGGGGGACCCAGG - Exonic
1140868298 16:79083379-79083401 CTGTGGTCACTCAGGGACCCAGG - Intronic
1141242179 16:82274332-82274354 CGGTGGTCAAAGAGGGCCCCTGG + Intergenic
1141262257 16:82464376-82464398 CTGTAATGACAGAGCGATCCAGG - Intergenic
1141717180 16:85733759-85733781 CTGGAGTCTCAGAGGAAGCCAGG + Intronic
1141825581 16:86477316-86477338 TTGTAATAACAGAGTGACCCGGG + Intergenic
1142237136 16:88927654-88927676 CAGCTGTCACAGAGGGAGCCGGG + Intronic
1142970210 17:3606322-3606344 CTGTCCTCACTCAGGGACCCAGG + Intergenic
1143001209 17:3796420-3796442 TTGGAGTCACTGAAGGACCCTGG + Intronic
1143520759 17:7443018-7443040 AGTTAGGCACAGAGGGACCCAGG - Intronic
1143786360 17:9258758-9258780 CTGGAGCCACAGAGGAAGCCTGG - Intronic
1144626166 17:16845418-16845440 CTGTAGTCACGGGCGGGCCCCGG + Intergenic
1144880267 17:18427302-18427324 CTGTAGTCACGGGCGGGCCCCGG - Intergenic
1145151966 17:20517085-20517107 CTGTAGTCACGGGCGGGCCCCGG + Intergenic
1145736035 17:27232277-27232299 CTGTAGCCACAGCGTGACCTTGG - Intergenic
1146163336 17:30571356-30571378 CTGTAGTCACGGGCGGGCCCCGG + Intergenic
1146975036 17:37103917-37103939 CTGTAGTCCCAGAGATACTCTGG + Intronic
1147580309 17:41624115-41624137 CTGTAGTCACGGGCGGGCCCCGG + Exonic
1147605648 17:41772386-41772408 CTGGAGTCTCTGAGGGAGCCTGG - Intronic
1147925196 17:43941589-43941611 CTGTAGTAACAGAGCCACGCAGG + Exonic
1147940215 17:44041481-44041503 CTGTGCTCACATAGGGAGCCAGG + Intronic
1149388606 17:56167713-56167735 ATGTAGTCACTCAGGGACCTAGG + Intronic
1149459325 17:56814328-56814350 ATCTACTCACAGAGGGAGCCTGG + Intronic
1152570052 17:81117743-81117765 CCGTGGCCACAGCGGGACCCAGG + Exonic
1153348640 18:4055160-4055182 CTGTGGTCACTGAGGGACACAGG + Intronic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154459949 18:14572914-14572936 CTGTAGACAAACATGGACCCTGG + Intergenic
1157157691 18:45283869-45283891 CTGTAGTCACAGAGGGCTAGTGG - Intronic
1159435709 18:68414402-68414424 CTGTAGTGACAGAGGTAACAAGG + Intergenic
1160094251 18:75856918-75856940 TGGCAGTCAAAGAGGGACCCAGG - Intergenic
1160262851 18:77311429-77311451 CTGGAGCCACAGAGGCTCCCAGG + Intergenic
1161793885 19:6375669-6375691 GGGAAGTCACAGAGGGTCCCTGG + Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1162825329 19:13247842-13247864 GTGCAGCCACAGAGAGACCCTGG - Intronic
1165139423 19:33689923-33689945 CTGGAGTCACAGAGGGCTGCTGG + Intronic
1165581095 19:36864473-36864495 CTGGAGTCACCCAGGTACCCAGG - Intronic
1166253593 19:41587111-41587133 ATGCATTCACAGAGGGACCCAGG - Intronic
1166257775 19:41618728-41618750 ATGCATTCACAGAGGGACCCAGG + Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166410429 19:42552876-42552898 ATGCATTCACAGAGGAACCCAGG + Intronic
1166739178 19:45103913-45103935 CTGTAGTTACAGTGGAGCCCTGG - Intronic
1167383931 19:49153274-49153296 CAGTAGCCACACAGGGACCCTGG + Exonic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1168344770 19:55644776-55644798 GAGGAGTCACAGAGGGAGCCAGG + Exonic
925359577 2:3268104-3268126 GTGGGGTCACAGAGGGACCAAGG - Intronic
926460055 2:13117957-13117979 CTGTAGTTAGAGATGGAGCCTGG - Intergenic
926644787 2:15277964-15277986 CTGCATTCACAGAAGTACCCAGG + Intronic
927917441 2:26946066-26946088 GTGAAGTCAGAAAGGGACCCTGG + Intronic
929092505 2:38233465-38233487 CTTAAGTCACATAGGGAACCTGG + Intergenic
930020797 2:47000977-47000999 CTGGAGGCACAGAAGGAGCCAGG + Intronic
932206843 2:69890806-69890828 GTGTAGTCACACAGGGTCCTGGG - Intergenic
932355431 2:71064607-71064629 CTGGAGTCACGGAGGGAGCCAGG - Intronic
934714307 2:96534737-96534759 CTGTAGGCACAGAGGCGTCCTGG + Intergenic
935981748 2:108634968-108634990 CTGGGGTCACAGAGGAACCCAGG + Intronic
936110558 2:109661122-109661144 ATGCAGTCACTTAGGGACCCAGG + Intergenic
937977688 2:127591715-127591737 CAGGAGTCTCTGAGGGACCCTGG - Intronic
940299927 2:152166078-152166100 CTGTAGTCCCAGATTGAACCTGG + Intronic
941451307 2:165664042-165664064 CTGAAGTCACAATAGGACCCTGG - Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
948024334 2:234764983-234765005 CTGCTGTCTCACAGGGACCCCGG + Intergenic
948351610 2:237345594-237345616 CTTTAGACACGGAGGGAGCCAGG - Intronic
1170040024 20:12030246-12030268 CTGATGTCACTCAGGGACCCAGG - Intergenic
1170502765 20:16991599-16991621 CTGAAGTCACAGATTGACCATGG + Intergenic
1172142860 20:32735766-32735788 CTGTAATCCCAGAGCAACCCAGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172637967 20:36422735-36422757 CTGCAGACACAGAGGCACCATGG + Intronic
1173365548 20:42381430-42381452 GAGCAGTCACACAGGGACCCGGG - Intronic
1173809565 20:45947817-45947839 CTGGGGCCTCAGAGGGACCCCGG + Exonic
1174536000 20:51251851-51251873 CTGTGGCCCCAGAGAGACCCAGG - Intergenic
1174945705 20:54982968-54982990 CTGTAATCCCAGAGAGACCGAGG - Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1175531572 20:59676741-59676763 TTATGGTCACAGAGGGATCCTGG - Intronic
1176814166 21:13579914-13579936 CTGTAGACAAACATGGACCCTGG - Intergenic
1176878021 21:14153644-14153666 CTGAAGTCCCAGAGGGGTCCAGG - Intronic
1177559406 21:22730557-22730579 CTGTAATCACTGAGGTACTCAGG - Intergenic
1179110849 21:38443843-38443865 CTGGAGTTACAGAAGGACCTGGG - Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181778523 22:25176905-25176927 CTGTATTCACACAGAGTCCCCGG - Intronic
1182103600 22:27673843-27673865 CTGAAGGGACAGAGGGACCTGGG - Intergenic
1182600387 22:31458696-31458718 CTGAAGCCACAGAGGGACACTGG - Intronic
1184231508 22:43160606-43160628 CTGCAGTCACAGACTGACTCAGG + Intronic
1184403902 22:44289270-44289292 TTGAAGTCAGAGAGGGACCTGGG - Intronic
951990221 3:28668301-28668323 CTGTAGTCACAGAAGCTCACAGG + Intergenic
952585409 3:34886734-34886756 CTGCAGTCCCACAGGCACCCTGG - Intergenic
954134713 3:48576645-48576667 CTGAAGTCCCAGAATGACCCAGG + Intronic
954880339 3:53831395-53831417 CTGTATTCACACAAGGCCCCAGG - Intronic
956598469 3:70994078-70994100 GTGTACTCACAGAGGGACTGTGG + Intronic
956663110 3:71618483-71618505 CTCTAGTCACAGATGGATCATGG - Intergenic
959584031 3:108009234-108009256 CAGTAGACACAGAAGCACCCAGG + Intergenic
959831253 3:110865322-110865344 CTGTAATAACAGAGAGTCCCAGG + Intergenic
959971337 3:112413588-112413610 CTGTAGTTAGACAGGGACACTGG + Intergenic
961576922 3:127844678-127844700 CTGTAGTCATTCAAGGACCCAGG - Intergenic
962817104 3:139011085-139011107 CTGTAGTCCCAGCAGTACCCAGG - Intronic
963913198 3:150832621-150832643 CTGTCGTAGCAGAGGGATCCGGG + Intergenic
966563082 3:181345281-181345303 CTGTAGTCACACAAGGCCTCAGG + Intergenic
969366297 4:6696356-6696378 CTGAAGTCACACAGGGAGCCGGG - Intronic
978149322 4:105414943-105414965 CTGTAGTCTCAGTGGGCCTCAGG - Intronic
981061197 4:140427280-140427302 CTGAAGACACAAAGGGTCCCAGG + Intronic
986032024 5:3903616-3903638 GCGTAGTCACAGAAGGCCCCAGG - Intergenic
986847828 5:11776224-11776246 CTGTAGTCACAGAGGACTTCAGG + Intronic
989987805 5:50722461-50722483 ATACAGTCACTGAGGGACCCAGG - Intronic
990357723 5:54986635-54986657 CTGTTTTCCCAGAGGGACCTAGG - Intronic
990818319 5:59809872-59809894 CTCTAGGCAGAGATGGACCCCGG - Intronic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
992421857 5:76614071-76614093 CTGTGGGCAGACAGGGACCCAGG - Intronic
994781191 5:104093034-104093056 CTCTAGTTACAAAGAGACCCAGG + Intergenic
995536087 5:113137990-113138012 GGGTAGTCACAGAAGGTCCCAGG + Intronic
999631984 5:153580833-153580855 CTGTATTCAGAGAGGCATCCTGG + Intronic
999643299 5:153693474-153693496 CTGTGGTCTCAGAGGCAGCCTGG + Intronic
1001266901 5:170280290-170280312 CTGTTCTCTCAGTGGGACCCTGG + Intronic
1002431214 5:179205165-179205187 CTGTTGTGACAGAGAGACCCTGG + Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002868820 6:1147516-1147538 CTGTCAGCACAGAGGTACCCTGG - Intergenic
1003429288 6:6024190-6024212 CTGTAGTGCTAGAGAGACCCCGG - Intergenic
1005000353 6:21233709-21233731 CTGTACTAACTCAGGGACCCAGG - Intergenic
1007444051 6:41890588-41890610 CTGTAGTCCCAGAGAGGTCCAGG + Intronic
1008841942 6:55913083-55913105 CTGTAGTCCCAGAGGTACTTGGG + Intergenic
1010057649 6:71585073-71585095 CTGTAGTCACGGGAGGGCCCGGG - Intergenic
1012019414 6:93898314-93898336 CTGGAGACACAGAGAGACACAGG - Intergenic
1013356544 6:109350364-109350386 CTGGAGTCTCAAAGTGACCCAGG + Intergenic
1016937102 6:149455590-149455612 CTGGAGGCAGAGAGGGACACAGG - Intronic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1022411355 7:30141004-30141026 CTGTGGTCACACAGGGAACAAGG - Intronic
1022702878 7:32777961-32777983 CTGCAGTCACAGAGGGATAGTGG + Intergenic
1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG + Intronic
1029405133 7:100370314-100370336 CTCTACTCCCTGAGGGACCCTGG - Intronic
1030601134 7:111594257-111594279 CTTTAGTCACACAGGGACTTTGG - Intergenic
1033428481 7:141266678-141266700 CTTTAGTCTCAGGGGGACTCAGG + Intronic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG + Intergenic
1035556674 8:572379-572401 CTGTAGTCACTCAGCAACCCTGG + Intergenic
1036642391 8:10592565-10592587 CTGTGGTCACAGTGAGACCCCGG - Intergenic
1037637824 8:20716313-20716335 GTGTGCTCACAGAAGGACCCTGG - Intergenic
1037898720 8:22675347-22675369 CTGAAGCCACAGAGTGTCCCAGG + Intergenic
1037922098 8:22814679-22814701 CTGCAGACAGAGAGGGACCATGG - Intronic
1038428280 8:27479463-27479485 CTGTATTGACAGACAGACCCAGG - Intronic
1040372214 8:46788215-46788237 CTGTAGCCAGAGTGGGTCCCTGG + Intergenic
1041181076 8:55248808-55248830 CTGGAGTCTCAGAGTGTCCCAGG + Intronic
1041212220 8:55563828-55563850 CTGAAGTCACAGGGGTAGCCAGG - Intergenic
1041249931 8:55924233-55924255 GTGAAGTCACAGAGGTGCCCTGG - Intronic
1044341094 8:91047177-91047199 CTGTAGTCACAGAAGAGTCCAGG + Intergenic
1046361230 8:113159474-113159496 CTGTAGTCACAGGAGAACTCAGG - Intronic
1049374252 8:142281503-142281525 CTGTAGTCACACAGCAGCCCTGG - Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049653074 8:143784650-143784672 CTGTAGTCTGTTAGGGACCCAGG + Intergenic
1050477372 9:6054102-6054124 TTGTAGTTACTCAGGGACCCAGG + Intergenic
1050810364 9:9738559-9738581 CTGTAATCACAGAAGGAGGCTGG - Intronic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1052998855 9:34566238-34566260 CCGGAGTCACAGAGAGACCCTGG - Intronic
1053472413 9:38356442-38356464 CTCTAGTCACTGAGGGACCTTGG - Intergenic
1056471069 9:86904794-86904816 CTGAAGTCCCAGGGGGATCCGGG + Intergenic
1058324412 9:103677788-103677810 GTGTAGGCACAGAGGGACGGTGG - Intergenic
1059399535 9:114060271-114060293 CTGTGGACACAGAGAGACTCAGG + Intronic
1059455804 9:114399358-114399380 CTGCACTCACAGCGGGACCTTGG - Intergenic
1060420711 9:123467745-123467767 GTGCAGTCACACAGGGCCCCAGG - Intronic
1060710609 9:125860134-125860156 TTGTAGTCACACAGGAATCCAGG + Intronic
1061261851 9:129484521-129484543 CTGTAGTGGGAGAGGGTCCCAGG - Intergenic
1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG + Intergenic
1061809389 9:133153653-133153675 CTGTCGTCCCAGAGGTACTCGGG + Exonic
1061997523 9:134194073-134194095 CAGTAGACACAGAGCTACCCAGG + Intergenic
1189540726 X:41985091-41985113 CTGGCTTCTCAGAGGGACCCAGG + Intergenic
1190556161 X:51637626-51637648 CAGCAGTAACAGGGGGACCCAGG - Intergenic
1192497088 X:71623196-71623218 CTGAAGTCACAGGGAGACCTGGG + Intergenic
1192498719 X:71634415-71634437 CTGTAGTCATCCAGGGACCCAGG + Intergenic
1195768279 X:108319785-108319807 CTGTAGCCAGAGAGGGACATGGG + Intronic
1197561268 X:128024853-128024875 CTGCACACACAGAGGGACCCTGG + Intergenic
1198017070 X:132622047-132622069 TAGTAGTCACAGAGGGCCCTCGG - Intergenic
1198576243 X:138013126-138013148 ATGTAGTCATTGAGGGACTCAGG + Intergenic
1199793070 X:151173056-151173078 CTGTAGTCCCAGAGCTACTCGGG + Intergenic