ID: 1034081250

View in Genome Browser
Species Human (GRCh38)
Location 7:148279629-148279651
Sequence AGGAGATGGGAGATAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 511}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034081250_1034081257 10 Left 1034081250 7:148279629-148279651 CCTGTCTTTATCTCCCATCTCCT 0: 1
1: 0
2: 7
3: 39
4: 511
Right 1034081257 7:148279662-148279684 ATAGATGTCTTGGCTTGACTAGG No data
1034081250_1034081258 27 Left 1034081250 7:148279629-148279651 CCTGTCTTTATCTCCCATCTCCT 0: 1
1: 0
2: 7
3: 39
4: 511
Right 1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 50
1034081250_1034081256 0 Left 1034081250 7:148279629-148279651 CCTGTCTTTATCTCCCATCTCCT 0: 1
1: 0
2: 7
3: 39
4: 511
Right 1034081256 7:148279652-148279674 CCTCAGGCAGATAGATGTCTTGG No data
1034081250_1034081259 28 Left 1034081250 7:148279629-148279651 CCTGTCTTTATCTCCCATCTCCT 0: 1
1: 0
2: 7
3: 39
4: 511
Right 1034081259 7:148279680-148279702 CTAGGACATTGATCGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034081250 Original CRISPR AGGAGATGGGAGATAAAGAC AGG (reversed) Intronic
900006180 1:54513-54535 AGGAGGTAGGAGAAAAAGCCAGG - Intergenic
900173843 1:1283387-1283409 AGGAGCTGGCAGAGAAAGATGGG + Intronic
900912001 1:5604028-5604050 GAGAGATGGGAGAGAAAGATGGG - Intergenic
901264716 1:7902005-7902027 ATGAGGTGGGAGAGAATGACCGG + Intergenic
901870859 1:12138476-12138498 GGCAGATGGGAGATGAATACGGG + Intronic
902450121 1:16491402-16491424 AGGAGAAGGGAGAGAAAGGGAGG + Intergenic
903186640 1:21633039-21633061 TGCAGATGAGAGAAAAAGACAGG - Intronic
904236766 1:29121857-29121879 AGAAGATGGGAGGCAAGGACTGG + Intronic
904464811 1:30701464-30701486 AAGAGATGGGGCATAGAGACAGG - Intergenic
904689256 1:32281654-32281676 AGGAAATGGAGCATAAAGACAGG + Intronic
906001216 1:42427318-42427340 AGTAGCTGGGAGATCAAGATCGG + Intergenic
906283720 1:44571810-44571832 ATGAAATGGGAGCTAAAGAAGGG - Intronic
906344672 1:45007714-45007736 AGGGGACTGGAGACAAAGACAGG - Intronic
907287803 1:53393175-53393197 AGGGGATGGGAGATACTGATTGG - Intergenic
907704620 1:56821639-56821661 AGGAGAGGGGAAAGAAAGAGAGG - Intergenic
907777886 1:57536719-57536741 AGGAGTTTGGAGAGGAAGACAGG - Intronic
908871827 1:68621595-68621617 AGGAGAAGAAAGATAAAGAGAGG - Intergenic
909087401 1:71183962-71183984 AGGAGATAGGTGAACAAGACTGG + Intergenic
909087463 1:71184767-71184789 AGGTGATGGGAGACAGTGACAGG - Intergenic
910462267 1:87460271-87460293 AAGAGATGGCAGAAAAAGACTGG + Intergenic
911063224 1:93765121-93765143 AGGAGTTGGGAGGAAAATACAGG - Intronic
911694597 1:100875446-100875468 AGGGGATGGGGGATAAAGGCTGG + Intronic
911787467 1:101968967-101968989 AGGAGAAGGAAGAAAAAGGCAGG - Intronic
912740711 1:112193437-112193459 AGGAGATGGCAGCAAAAGAAAGG + Intergenic
913264449 1:117030822-117030844 AAGAGGTGTGAGATAAAGAGGGG - Intronic
913300113 1:117361211-117361233 AAGAGTTGGTAGATAAAGAGAGG - Intergenic
913375218 1:118144006-118144028 AGGAGAGGGGAGGTAGACACTGG - Intronic
913559580 1:120004208-120004230 AGGAAATGGGAGGAATAGACAGG + Intronic
913638280 1:120786333-120786355 AGGAAATGGGAGGAATAGACAGG - Intergenic
914280168 1:146163629-146163651 AGGAAATGGGAGGAATAGACAGG + Intronic
914423738 1:147554919-147554941 AGGAGATTGAAGAGAAAGAAAGG - Intronic
914541213 1:148614568-148614590 AGGAAATGGGAGGAATAGACAGG + Intronic
914625427 1:149456677-149456699 AGGAAATGGGAGGAATAGACAGG - Intergenic
914867200 1:151441272-151441294 AGGAGATGTGAGACGAAGAAGGG - Intronic
915167739 1:153958073-153958095 CGGAGAGGGGAGATGAAGTCCGG - Intronic
915543386 1:156582582-156582604 AGGAGATGGGACAGCCAGACAGG + Intronic
916858818 1:168780560-168780582 AAGAGATGGGGCAGAAAGACGGG - Intergenic
917053397 1:170950597-170950619 AGGGGATGGGAGCTAGAGAAGGG + Intronic
917060874 1:171037325-171037347 GGGAGATGGGAGATAGGGAGAGG + Intronic
917160630 1:172053305-172053327 AGGGGATGGCAGGTAAACACAGG - Intronic
917255710 1:173114096-173114118 AGGAGATTGAAGATGAAGATGGG - Intergenic
918644304 1:186885058-186885080 AGGACTTGGGGTATAAAGACTGG + Intronic
919838494 1:201592817-201592839 CTGAGCTGGGAGGTAAAGACTGG - Intergenic
920173042 1:204083457-204083479 AGATGATGGGAGATAGAGAGAGG - Intronic
921301291 1:213753751-213753773 AGAAGATGGGAGTTGAAGTCGGG - Intergenic
923692895 1:236213323-236213345 AGGTGATGGCAGATAGAGGCAGG - Intronic
924048361 1:240055327-240055349 TGGAGATAGGGGATGAAGACAGG - Intronic
924133405 1:240936920-240936942 AAGAGATGTGAGTTACAGACTGG - Intronic
924264854 1:242270841-242270863 AGGTGAAGGAAGGTAAAGACTGG - Intronic
924424045 1:243934064-243934086 AGGGGAGGGGAGATAAAGGTAGG - Intergenic
924654026 1:245956632-245956654 AGAAGGAGGGAGACAAAGACAGG - Intronic
1063167504 10:3477118-3477140 AGGAGATGGGAGAGAAGAAGAGG + Intergenic
1063672147 10:8107721-8107743 AGGAGTTAGGAAATAAATACTGG - Intergenic
1063765952 10:9140634-9140656 AGAAAATAGGAAATAAAGACCGG - Intergenic
1064369278 10:14737259-14737281 AGGAGGTGAGAGAGAAAGAGAGG + Intronic
1064490384 10:15849735-15849757 AAGAGATTGAAGATAAAGAGAGG - Intronic
1065285428 10:24182951-24182973 AGGAGATGGGATATAGTGAGAGG + Intronic
1067468329 10:46517830-46517852 AGGAGTTGAGAGTTAGAGACAGG + Intergenic
1067840688 10:49676117-49676139 TGGAGGTGGGAGATGAAGAGAGG + Intergenic
1068258748 10:54549979-54550001 AGGAGTTAGGAGATAAAATCTGG - Intronic
1069367568 10:67710326-67710348 AGGAGATGGGAGGTACTCACAGG + Intergenic
1069756972 10:70779444-70779466 AGGAAATGGGAGAAAAAGTGGGG + Intronic
1070681513 10:78452285-78452307 AGGAGAAGGGAGAGACAGAAAGG + Intergenic
1070946802 10:80398908-80398930 AAGAAATGGGAGATAATTACAGG + Intergenic
1071185536 10:83039843-83039865 AGGAGAAGGAAAAGAAAGACAGG - Intergenic
1071827989 10:89344360-89344382 AGGAGATGGAAGACAAAGTCTGG + Intronic
1071829612 10:89358781-89358803 AGGGGAGGGAAGATAAAGAGGGG + Intronic
1072953568 10:99869757-99869779 AGGAGATAGGAGGTTTAGACTGG - Intergenic
1074311643 10:112327773-112327795 GGGTGATGGGAGATAAAAAGGGG + Intergenic
1074943296 10:118255627-118255649 AGGAGGTGGGAGGGAAGGACGGG - Intergenic
1075103105 10:119519616-119519638 AGGAGCTGGGAGACAGATACAGG - Intronic
1075913420 10:126146068-126146090 GGTAGTTGGGAGAAAAAGACAGG + Intronic
1076082682 10:127597914-127597936 AAGAGAAGGGAGATAGAGTCTGG + Intergenic
1077772344 11:5233765-5233787 GGGGGTTGGGAGAGAAAGACAGG + Intronic
1078197989 11:9152668-9152690 AGGAGATGGGAAAGAGAGCCTGG + Intronic
1079065403 11:17286741-17286763 AAGAGATGAGTGATAAGGACAGG - Intronic
1079975379 11:27084286-27084308 AGAAGATGGGGAATTAAGACAGG - Intronic
1080225097 11:29950903-29950925 AGGAGTTGGAAGCTAAGGACTGG + Intergenic
1081103973 11:39041267-39041289 AGGGGAGGGAAGACAAAGACAGG + Intergenic
1081674289 11:44959580-44959602 AAGAGCTGGCAGATGAAGACTGG - Intergenic
1081692303 11:45086759-45086781 GGGAAATGGGAGATAAGGCCAGG - Intergenic
1082610418 11:55289824-55289846 GGGAGATGGGAGGGAAATACAGG + Intergenic
1082813038 11:57490086-57490108 AGAGGATGGGAGAAAGAGACTGG - Intronic
1083261794 11:61527100-61527122 CAGAGATAAGAGATAAAGACCGG + Intronic
1083854003 11:65383215-65383237 AGGAGAAGGGAGAGAAGGACTGG - Intronic
1084691727 11:70731406-70731428 AGGAGATGGGGGAGAAGGAGCGG - Intronic
1085504970 11:77053229-77053251 TGGGGAAGGGAGAGAAAGACGGG + Intergenic
1085511738 11:77091650-77091672 AGGCGATGGGAGAGGAAGAGGGG + Intronic
1085858635 11:80206204-80206226 AATAGATGGAAGATAAAGAGTGG - Intergenic
1087983126 11:104642190-104642212 TGGGAATGGGAGATAAAGACGGG - Intergenic
1088123739 11:106398753-106398775 AGGAGAAGAGAGAGAAAGAAAGG - Intergenic
1088243732 11:107796637-107796659 TGGGGGTGGGAGATAAAGAGAGG + Intronic
1088376922 11:109151529-109151551 AGGAGAGAGGAGAGAAAGAGAGG - Intergenic
1088740632 11:112764105-112764127 AAGAGATGGGATTTAAAGTCAGG - Intergenic
1089879305 11:121758191-121758213 AGGAGAAGGGAGAAAAAGGGAGG - Intergenic
1090001725 11:122966731-122966753 AGGAGAGGGGAGAAACAGAAAGG - Intergenic
1090413611 11:126526037-126526059 ATGAGATGGGAAGAAAAGACAGG - Intronic
1090563043 11:127953958-127953980 AGAAGATGGGAGATAGTGCCAGG + Intergenic
1090604769 11:128410129-128410151 AGGAGATTGGAGATATAGACAGG - Intergenic
1091017364 11:132064108-132064130 GGGAGATGAGAGAGAAAGAAAGG + Intronic
1091280248 11:134377730-134377752 TGGATGTGGGAGATAAAGAGAGG - Intronic
1091332956 11:134744785-134744807 AGGGAATGGGAGAGAGAGACAGG + Intergenic
1092092176 12:5812265-5812287 AGGAGAAGGGAGGGAAACACAGG + Intronic
1092184916 12:6471444-6471466 AGCAGAGGGGAGATAATCACTGG - Intergenic
1092189575 12:6508977-6508999 AGATGATGAAAGATAAAGACTGG + Intronic
1094360572 12:29626318-29626340 AGTAAAAGGGAGATAAAGAAAGG + Intronic
1094502238 12:31032019-31032041 AGGAAAGTGGAGATAAAGACAGG - Intergenic
1094561461 12:31557730-31557752 AGGAGAAGAGAGAAAAAGAAAGG + Intronic
1095334566 12:41010105-41010127 AGGAGAAGAGAGAGAGAGACTGG + Intronic
1095902770 12:47345488-47345510 TGGGGATGGGAAATAAAGAGAGG + Intergenic
1096230073 12:49891901-49891923 AGGAGGTGGGAGATGATGGCTGG + Intronic
1096742193 12:53702081-53702103 AGGAGATAGGAGGGAAAGGCGGG - Intergenic
1098797519 12:74909742-74909764 AGGAGCTTGTAGATAAACACTGG + Intergenic
1099589068 12:84562939-84562961 AGTAGAGGGGAAATGAAGACAGG + Intergenic
1099650651 12:85423858-85423880 AGGAGAAGGAAGACAATGACAGG - Intergenic
1099925687 12:89013731-89013753 ATGAGATGGTAGATAATTACAGG + Intergenic
1100829438 12:98504166-98504188 AGTAAATGGAAGAGAAAGACTGG + Intergenic
1101238319 12:102812621-102812643 AGGAGATGAGAGGGAAAGAGGGG + Intergenic
1101265560 12:103082402-103082424 AGGAAATGGGGGAAAAACACTGG - Intergenic
1101275827 12:103199818-103199840 AGAAAATGGAAGATAAATACTGG + Intergenic
1101523048 12:105502682-105502704 AGGAAATGGGAGCGAAAGAAAGG + Intergenic
1101664139 12:106794358-106794380 AGGAGAGGAGAGAGAAAGAAAGG + Intronic
1101830615 12:108253655-108253677 AGGAGATGGGAGAGGACAACAGG - Intergenic
1103689194 12:122757010-122757032 GGGAGATGGGAGAAATAAACTGG + Intronic
1104191660 12:126487368-126487390 TGGAGATGGTAGATAAACATGGG + Intergenic
1104232499 12:126898693-126898715 AAGAGATAGGAGAGAAAGAGAGG + Intergenic
1104486764 12:129157983-129158005 ATGAGATGCGAGATAAAGTAGGG + Intronic
1105639118 13:22244241-22244263 AGGAAATGGGCGAAAAAGACGGG - Intergenic
1105650027 13:22367166-22367188 AGGAAATGAGAAAGAAAGACGGG - Intergenic
1105924468 13:24995152-24995174 AGGAGAAGAGAGAGAGAGACTGG - Intergenic
1106216769 13:27708678-27708700 AGGTGATGGGAGACAGACACAGG + Intergenic
1106398483 13:29404507-29404529 AGGAGACGGGGGACAAATACTGG - Intronic
1106732689 13:32557938-32557960 GGGAAAGGGGAGATAAAGAGAGG + Intergenic
1107319284 13:39168373-39168395 AGGAGCTGGGAGAGTAAGATGGG - Intergenic
1107986454 13:45780608-45780630 GGGAGCAGGGAGAGAAAGACTGG - Exonic
1108454400 13:50598333-50598355 AGGAGATGAGAGAGAGAGATGGG - Intronic
1109267773 13:60220932-60220954 AGGAGATGGGGAATGCAGACTGG - Intergenic
1109303224 13:60611123-60611145 AAGAGATGGAAAATAAAGCCAGG - Intergenic
1109490160 13:63087299-63087321 CTGAGATGGGATAGAAAGACTGG + Intergenic
1111507329 13:89209547-89209569 AGAAGAAGGAAAATAAAGACTGG - Intergenic
1111720771 13:91941417-91941439 AGGAAGGGGGAGATAGAGACAGG - Intronic
1113057162 13:106281278-106281300 AGGAGATGGGAGGAGGAGACAGG - Intergenic
1113556434 13:111239400-111239422 AGGAGCAGGGAGGAAAAGACAGG - Intronic
1113909848 13:113836633-113836655 AGGAGAGGGGAAATAAGGATGGG + Intronic
1114646778 14:24260401-24260423 GGTAGATGGGAGGGAAAGACAGG - Intronic
1114690139 14:24573823-24573845 AGGAGAAGGGAGACTGAGACAGG + Intronic
1115464676 14:33702036-33702058 AGAAGATGCAAGATAAAAACTGG + Intronic
1115628938 14:35224029-35224051 AGGAAATGAGAGAGAAAGAAAGG - Intronic
1115739840 14:36376544-36376566 AGGTGATGGGAGACAGTGACAGG + Intergenic
1115883549 14:37946339-37946361 AGGAGTTGGGAGCTGAAGATTGG + Intronic
1116042877 14:39707120-39707142 AGAAGATGGGGAATAAAGAATGG - Intergenic
1116291010 14:43040627-43040649 AGGAGATGACATATAAAGAAGGG + Intergenic
1116667984 14:47802086-47802108 AAGATATGGGAGATGCAGACGGG - Intergenic
1117167183 14:53048006-53048028 AGGAGATTGGAGAAAAAGTTGGG + Intronic
1117544961 14:56785833-56785855 AAGACAAGGGAGATAAGGACAGG - Intergenic
1117828771 14:59729780-59729802 AGGAGAGGGCAGAGAAAGAAAGG - Intronic
1118789506 14:69077148-69077170 AGCAGATGGGGGCAAAAGACAGG - Intronic
1122202640 14:100131873-100131895 CTGAGATGGGAGCTAAAGAAGGG + Intronic
1122306322 14:100768992-100769014 ACAAGATGGGAGAGAAAAACTGG - Intergenic
1122393649 14:101407604-101407626 AGGATGTGGGAGAACAAGACAGG + Intergenic
1122920844 14:104879534-104879556 AGGAGATCGGAGAGACTGACAGG - Intronic
1123082191 14:105700639-105700661 CAGAGATGGGAGAAAAAGAGAGG - Intergenic
1123110417 14:105864512-105864534 TGGAGCTGGGAGATAATGTCCGG - Intergenic
1123847652 15:24319273-24319295 AGTAGATGGAGGATAAAGAAAGG + Intergenic
1124530130 15:30498422-30498444 AGGAGATATGAGATACAGATAGG + Intergenic
1124768529 15:32509266-32509288 AGGAGATATGAGATACAGATAGG - Intergenic
1125654596 15:41345759-41345781 AGCAGATGGGAGATTAAAATAGG - Intronic
1125660622 15:41391968-41391990 GAGAGATGGAAGATGAAGACAGG + Intronic
1125660625 15:41391993-41392015 GAGAGATGGAAGATGAAGACAGG + Intronic
1125911850 15:43447182-43447204 AGGAGATGAGGGGTAAAGAGAGG - Intronic
1126096460 15:45094278-45094300 AGGAGATTGGAGAGAGAGAGGGG + Intronic
1126106704 15:45151571-45151593 GGGAGTTGGGAGCTACAGACTGG + Intronic
1126132228 15:45353050-45353072 GGGAGGTGAGAGATGAAGACAGG + Intergenic
1126391535 15:48160366-48160388 AGGAGAGGAGAGATAAAGGAGGG + Intronic
1126393911 15:48191499-48191521 AGGAGGTGGGAGATGAGGAGGGG - Intergenic
1127024000 15:54782151-54782173 CGGAGATGGGAGACGGAGACGGG + Intergenic
1127862816 15:63008617-63008639 AAAAGGTGGGAGACAAAGACAGG + Intergenic
1128225977 15:66001635-66001657 GGGAGATGAGAGAGAAAGAAAGG - Intronic
1128241779 15:66106174-66106196 AGGAGATGGGAAACAATGATGGG + Intronic
1128835608 15:70806933-70806955 AAGAGGAGGGAGATAAAGAGGGG + Intergenic
1128863754 15:71096569-71096591 AGGAGGTGGGAGAAAATGAAAGG - Intergenic
1128879826 15:71232680-71232702 AGGGGAAGGGAGACGAAGACCGG + Intronic
1129078106 15:73014898-73014920 TTGAGATGGGAGATAAACCCAGG - Intergenic
1129697815 15:77750553-77750575 AGGAGGTGGGAGAGATAGACAGG - Intronic
1129766200 15:78170181-78170203 AGGAGAAGGGAGAGGAAGACAGG - Exonic
1130206230 15:81878298-81878320 AGGAGAGGGGAGAGAGAGAGGGG - Intergenic
1130532852 15:84760785-84760807 AAGAGATGGGGTATAGAGACTGG - Intronic
1130744793 15:86639548-86639570 AGTAGATGGGAGGGAAAAACTGG - Intronic
1131077893 15:89509591-89509613 ATGAGATGGGAAAAGAAGACTGG + Intergenic
1131078128 15:89511543-89511565 ATGAGATGGGAAAAGAAGACTGG + Intergenic
1131131861 15:89905453-89905475 AGGAGTGGGGAGAGAGAGACAGG - Intronic
1131171177 15:90179340-90179362 AAGAGAAGGGAGTTAGAGACTGG + Intronic
1131258642 15:90877229-90877251 AGGAGAAGGGAGGCAGAGACCGG - Intronic
1132447340 15:101936410-101936432 AGGAGGTAGGAGAAAAAGCCAGG + Intergenic
1133373413 16:5263582-5263604 AGGGAATGGGTGATAAAGGCAGG + Intergenic
1133780642 16:8936351-8936373 AGGAGATGAGAGGTCAAGAGAGG - Intronic
1134031874 16:10998642-10998664 AGGAGAAGGGAGGGAAAGAAGGG - Intronic
1134336098 16:13300899-13300921 AGGAGGTGGGAGAGGAAGAGAGG - Intergenic
1134602220 16:15542374-15542396 AGCAAATGTGTGATAAAGACAGG - Intronic
1135944602 16:26854834-26854856 AAGAGATGGGAGTGAAAGAAGGG + Intergenic
1136223730 16:28845145-28845167 AGGAGATGGTAGAGAAAGGTGGG - Intronic
1137441113 16:48499117-48499139 GGCAGAAGGGAGATAAAGTCAGG - Intergenic
1138209107 16:55148065-55148087 AGAAGATGGGAAAGTAAGACAGG - Intergenic
1139759436 16:69172573-69172595 TGGAAATGGGAGATCAAGAAGGG + Intronic
1140864570 16:79048928-79048950 CAGAGATGGGAGTTAAACACAGG + Intronic
1140892095 16:79293653-79293675 AAGAGTTGGGAGAAAAAGAGTGG - Intergenic
1141097267 16:81171752-81171774 AGGAGATGGGTGATGGAGGCAGG + Intergenic
1141108152 16:81250380-81250402 AGGAGAGGAGAGATGAAGCCAGG - Intronic
1142187398 16:88701076-88701098 AGGAAGTGAGAGATGAAGACGGG + Intronic
1143439211 17:6955240-6955262 AGAAGATTAGAGATTAAGACTGG - Intronic
1143558865 17:7679919-7679941 AAGATTTGAGAGATAAAGACAGG - Intronic
1143697856 17:8633309-8633331 AGGTGTTGGGAGAAAAAGAAAGG - Intergenic
1144237722 17:13278210-13278232 AGCATATGGGGGATAAAGAAAGG + Intergenic
1145772949 17:27506650-27506672 GGGAGATGGGAGATAAAGGCTGG - Intronic
1146386625 17:32382655-32382677 TGGAGATGGGAGAGAGAGAGAGG + Intergenic
1146520180 17:33520270-33520292 AGGATACGGGACAGAAAGACAGG + Intronic
1146771439 17:35571980-35572002 AGGACATGGAAGATAAAGCAGGG - Intergenic
1147837560 17:43345451-43345473 TGGAGATGGGCAATAAAGTCTGG + Intergenic
1148645473 17:49217655-49217677 AGGAGGAAGAAGATAAAGACTGG - Intronic
1148784088 17:50136853-50136875 AGGAGCTGGGAGCTAAAGCTGGG - Intronic
1148807736 17:50272690-50272712 AGGTAATGGGAAATAGAGACAGG + Intronic
1149017083 17:51920374-51920396 AGGAGGTTGGAGATAAAGACTGG + Intronic
1149025895 17:52027093-52027115 GGGCGATGGGAGATAGTGACAGG + Intronic
1149345092 17:55726548-55726570 AGCAAATTGGAAATAAAGACAGG - Intronic
1150022410 17:61630939-61630961 AGGAGGTGGGATGTAAAGAGAGG - Intergenic
1150509797 17:65738817-65738839 AATAAATGGGAGATAAAAACCGG + Intronic
1150915630 17:69433885-69433907 ATGAGATAGGAGAAATAGACAGG + Intronic
1150965154 17:69959777-69959799 AGGAGATGGGAGATCACAGCAGG + Intergenic
1151035221 17:70791432-70791454 ATGAGATGGGAGATGAGGAAAGG + Intergenic
1151885030 17:76918405-76918427 AGGAGATGGGAGCTGAGGGCAGG + Intronic
1152157356 17:78643629-78643651 AGGAAATGAGAGCTAAAGACGGG - Intergenic
1155087654 18:22473460-22473482 AGAAGAGGGGAGAAAAACACAGG + Intergenic
1155544567 18:26902279-26902301 AGGAGATTGGAGCTCAAGAAAGG - Intergenic
1155775141 18:29752207-29752229 AGGAGATGTGAAAGGAAGACAGG - Intergenic
1156015356 18:32541090-32541112 AGGAAGTGGGAGATGAAGAGTGG - Intergenic
1156154012 18:34280324-34280346 AGGAGATGCTAGCTAAAGATTGG + Intergenic
1156829621 18:41476022-41476044 TGGAGAAGAGAGATAAAGAAAGG + Intergenic
1158763355 18:60417072-60417094 AGAAGATGGGAGATGAATAAAGG - Intergenic
1158800660 18:60904668-60904690 AGGAAATGGAAGATGAAAACGGG + Intergenic
1160200340 18:76790611-76790633 AGGAGAAAGGAGAGAAAGAAAGG + Intergenic
1160637934 19:96123-96145 AGGAGGTAGGAGAAAAAGCCAGG - Intergenic
1161479663 19:4504240-4504262 AGGAGGTGGGAGATGCAGGCAGG + Exonic
1162925263 19:13927809-13927831 AGGACAAGGGAGAACAAGACTGG - Intronic
1163522021 19:17797026-17797048 ATCAGCTGGGAGTTAAAGACAGG + Intronic
1164450193 19:28355207-28355229 AGGTGATGGGAGACAGTGACAGG - Intergenic
1165105495 19:33467455-33467477 AGAAGTCGGGAGGTAAAGACGGG + Intronic
1166175714 19:41068001-41068023 AGGAGATGGAAGAGAAAGCTAGG + Intergenic
1166911329 19:46160397-46160419 AGGAGCTGGGAGAGAAAGAAAGG - Exonic
1167115762 19:47488244-47488266 AGCAGATGGGACAGGAAGACGGG + Exonic
1167264665 19:48477732-48477754 TAGTGATGGGAGACAAAGACAGG - Intronic
1167527651 19:49994940-49994962 AGGAGGTGGGAGATGAACAGGGG + Intronic
1167601887 19:50459394-50459416 AGGAGGTGGGAGATGAAGGGTGG + Intronic
1167853571 19:52220276-52220298 AGGAGATGGGAGCTCCAGAAAGG + Intronic
1168061897 19:53897973-53897995 AGGGGATGGGAGAGGAAGAGGGG - Exonic
925686142 2:6475871-6475893 AGGACCTGGGAGATGCAGACAGG + Intergenic
925748796 2:7068708-7068730 GAGAGATGGCAGATAGAGACGGG + Intergenic
926198084 2:10775545-10775567 AGGACACGGGAGGTAAATACAGG - Intronic
926436268 2:12841283-12841305 AAGAGATGGAAGCTAAATACAGG + Intergenic
927088063 2:19690191-19690213 AGGAGAGGAGAGATAAGGAGAGG + Intergenic
927679316 2:25129608-25129630 AGGAGATGGGAGATGAAGATAGG - Intronic
927995586 2:27483384-27483406 AGGAGAAAGGAGAGAAATACAGG + Intronic
929008663 2:37419690-37419712 ATGAGATGGGAGCTAAACCCAGG + Intergenic
929083396 2:38144364-38144386 AGGTGGTGGGAGCTAAAAACTGG - Intergenic
929470331 2:42185627-42185649 TGGAGATGAGAGATGAAGGCAGG + Intronic
931093524 2:58913598-58913620 GGGAGAGGGGAGAGAAAGAGGGG - Intergenic
931641435 2:64383973-64383995 AGGAGATGAGAGATGAGAACAGG - Intergenic
933038372 2:77429694-77429716 AGGAGCTGGGACAGAAAGAAGGG + Intronic
933061801 2:77747373-77747395 AGGAGATAGGAGATAGAGACAGG + Intergenic
933792049 2:85890683-85890705 AGGACAGGGGAGACAAAGAGAGG - Intergenic
938720465 2:134063387-134063409 GGGAGATGGGAGAGGGAGACGGG - Intergenic
938737054 2:134195526-134195548 CCGATATGGGAGATAAAAACAGG - Intronic
938929741 2:136076198-136076220 AGGAGATGGAGGATAAAAATTGG - Intergenic
938961842 2:136351195-136351217 AGGTGATGTGAGGTAATGACAGG + Intergenic
939003971 2:136765320-136765342 AGGAGAGGGGGGAGAAAGAGGGG + Intergenic
939273648 2:139971392-139971414 TGGAAAGGGGAGATAAGGACAGG + Intergenic
940129386 2:150363643-150363665 AGGAGGTGAGAGAACAAGACAGG - Intergenic
940557086 2:155243040-155243062 AGGAGTTGGGACATAAGGAGAGG - Intergenic
941213596 2:162676068-162676090 AGGACATGAGAGTTAAATACAGG - Intronic
942331280 2:174827514-174827536 AGGAGATAGGAGAGGCAGACAGG + Intronic
942353287 2:175077814-175077836 AGGTGAGGGGAGAAAATGACTGG + Intronic
942631380 2:177953653-177953675 AGGAGATGGGAAATAGGGAATGG - Intronic
944835782 2:203578315-203578337 AAGAGATTGGAGATAAAAGCAGG + Intergenic
944996576 2:205301545-205301567 AGGACATGGAAAATAAAGCCAGG + Exonic
945628871 2:212245879-212245901 GGGAGATGGGAGAAAAATTCAGG + Intronic
946045236 2:216815433-216815455 AGGAGATGGTAGATACGGGCTGG + Intergenic
946111510 2:217422121-217422143 ATGAGATGAGAGGGAAAGACAGG - Intronic
946739241 2:222785482-222785504 AGGAGATGGGAGAAAACCTCTGG + Intergenic
947387067 2:229600997-229601019 GTGATATGGGAGAGAAAGACTGG + Intronic
947442426 2:230134784-230134806 AGCAGATGGGTGTTAAGGACTGG - Intergenic
948329212 2:237151703-237151725 AGGAGAAGGTAGAGAAAAACTGG - Intergenic
948347104 2:237307890-237307912 TGCAAATGGGAGATCAAGACTGG - Intergenic
948949414 2:241239336-241239358 AGGAGAGGGGAGAGAGAGAGAGG - Intronic
1170307986 20:14960646-14960668 AGCAGAGGGGAGATAATGACAGG - Intronic
1172190518 20:33059574-33059596 AGGAAATGGGGGATACAGAGGGG - Intronic
1172865686 20:38095366-38095388 AGGTGATGGGAGATGAGGATGGG + Intronic
1174121746 20:48271068-48271090 AGGACCTGGGAGCTAAAGAAAGG - Intergenic
1174753215 20:53132641-53132663 AGGAGAATGGAGAGAAAGAGAGG - Intronic
1176516330 21:7786542-7786564 AGGAGATGGGATGCAACGACTGG + Intergenic
1178308160 21:31508053-31508075 AGGACATGGAAGACACAGACAGG + Intronic
1178600948 21:33993741-33993763 AGGGGAGGGGAGCTAAAGATGGG - Intergenic
1178631274 21:34263545-34263567 AGGAGCTGGAAGGTAAAGAGGGG - Intergenic
1178650358 21:34416554-34416576 AGGAGATGGGATGCAACGACTGG + Intergenic
1178802149 21:35806148-35806170 AGGAGATGATCAATAAAGACTGG + Intronic
1178989535 21:37341357-37341379 AGGGGGTGGGAGAGAAAGAGTGG - Intergenic
1179091148 21:38266906-38266928 AGGAGGTGGGAGTTAAACATAGG + Intronic
1179570016 21:42273216-42273238 AGGAGAGGGGAGCCAGAGACGGG - Intronic
1181034029 22:20161434-20161456 GGGAAATGGGTGATAAAGGCAGG - Intergenic
1181375221 22:22452842-22452864 AGGAGATGTGAGTTACAGATTGG - Intergenic
1181854233 22:25770813-25770835 AGGAGATGGGAGGGGAAGAGGGG - Intronic
1181887948 22:26036613-26036635 AGGAGATGGGAGATGGAAAGAGG - Intergenic
1182031560 22:27163160-27163182 GGGAGAAGGGAGATAAAGAAGGG + Intergenic
1183095414 22:35549011-35549033 AGGAGAGGGGAGATGTAGAGAGG + Intronic
1184521579 22:44997726-44997748 AGGGGAAGGGAGAGAAAGAGAGG - Intronic
1184670987 22:46012279-46012301 AGGAGAAAGGAGATAAGGATGGG + Intergenic
1184872390 22:47249306-47249328 AGAAGAGGGGAAATAAAGGCAGG - Intergenic
1185015272 22:48339213-48339235 AGGGGATGGGAGAGAGAGATTGG + Intergenic
1185359244 22:50395467-50395489 AGGAAGTGGGAGATACATACAGG + Intronic
949808383 3:7979262-7979284 ATGAGATGGGATATAAATATAGG - Intergenic
950088807 3:10280235-10280257 AGGAGATGCGGGAGAAGGACTGG - Exonic
950098569 3:10344062-10344084 AGGAGGTGAGAGAGAAAGCCAGG - Intronic
950609981 3:14120264-14120286 TGGAGATGTGAGAGAAAGACGGG - Intronic
951180424 3:19653005-19653027 AAGAGATGGGAGCTATAGATAGG - Intergenic
951316826 3:21197239-21197261 GGGAAAGGGGAGATAAAGAAAGG - Intergenic
951893660 3:27589911-27589933 GGGGGATGGGAGATAGAGATTGG - Intergenic
952960918 3:38588689-38588711 AGGAGGTGGGGGTCAAAGACGGG + Intronic
953011327 3:39028008-39028030 GGGAGATGGGAGAAAAATCCAGG - Intergenic
953041092 3:39255546-39255568 AAAAGATGGGAGACAAAGGCTGG + Intergenic
953525842 3:43689714-43689736 GCTAGATGGGTGATAAAGACAGG + Intronic
953590823 3:44251753-44251775 AGGAGAGGAGAGAGTAAGACAGG - Intronic
955513316 3:59702999-59703021 AGGAGAGGGGAGATTAAGAAAGG - Intergenic
956219477 3:66886648-66886670 AGAAGATGTGACATAAGGACAGG - Intergenic
957863514 3:85991028-85991050 CAGAGATGGGAGATAAACCCTGG + Intronic
959261702 3:104090417-104090439 AGGGGAGGGGACATAAAAACAGG - Intergenic
959381767 3:105649522-105649544 AGAAAATGGAAGAAAAAGACAGG - Intergenic
959950919 3:112179207-112179229 ATGAGAAAGGGGATAAAGACAGG - Intronic
960135059 3:114096449-114096471 AGGACCTGTGAGAAAAAGACAGG - Intergenic
960456774 3:117882105-117882127 AGGTGATGGGAGATATTGAAAGG - Intergenic
961090544 3:124107551-124107573 AGGAGAAGGGAGTTAAGGACAGG - Intronic
961185321 3:124910151-124910173 AAGAGAAGGGAGATAAGGAGAGG - Intronic
961345499 3:126260821-126260843 AGGAGAAGGAAGATGAAGAGAGG - Intergenic
962229377 3:133647857-133647879 AAAAGATGGAAGATAAGGACAGG + Intronic
962953228 3:140240858-140240880 TGGAGAGGGGATATAAAGGCAGG - Intronic
963605047 3:147406225-147406247 AGGAGATGGGGCAGAAAGACTGG + Intronic
963874835 3:150463371-150463393 AGGAGGTGGGAGAAAAGGTCTGG - Exonic
964046259 3:152331088-152331110 GGGAGAAGGGAGAGAAAGAGAGG - Intronic
964445890 3:156756879-156756901 ATGAGATGTGAGATATAGACTGG + Intergenic
965078928 3:164012937-164012959 ATGAGATGGAACAAAAAGACAGG - Intergenic
966675656 3:182585299-182585321 AGGGGAGGGGGGATAAAGAGAGG + Intergenic
967822475 3:193850828-193850850 AGGTGCTGGGAGTTAAAGACAGG + Intergenic
967940051 3:194758739-194758761 AGGTGAAGGGAGATCAACACAGG + Intergenic
968298819 3:197598060-197598082 AAGATATGGGAGATAATGCCAGG - Intergenic
969152368 4:5180441-5180463 AGGAGATGGGACATGAAGCCAGG + Intronic
970820994 4:20213586-20213608 AAGAGATGGGAGATAAAGCCTGG - Intergenic
970869934 4:20804153-20804175 AGGAAATGAGAGATAAAGCATGG - Intronic
971195515 4:24469849-24469871 AGGAGGTGGGAGAGAGGGACTGG - Intergenic
971599242 4:28571035-28571057 AGGAGATTTGAGACACAGACAGG + Intergenic
972127715 4:35790136-35790158 AGGGGAGGGGAGAAAAAGAAAGG + Intergenic
972183087 4:36493630-36493652 AGGATATGGGAAATAAAGCAAGG + Intergenic
972938618 4:44169415-44169437 TGGAGACTGGAGAAAAAGACTGG + Intergenic
973884489 4:55306748-55306770 AGGAGATGTGAGAGAGAGAAAGG - Intergenic
975151405 4:71025778-71025800 AAGAGATGGAAGAAAAAGGCAGG - Intronic
975179833 4:71332323-71332345 AAGAGAAGGGAGAGAAAGATTGG - Intronic
975956250 4:79843462-79843484 ATGGGAAGGGAGGTAAAGACAGG - Intergenic
976022537 4:80646737-80646759 AGGAGAAGGGAGATAAGGGAAGG - Intronic
976805454 4:89041094-89041116 AGTATAAGGGAGATAAAGAGAGG + Intronic
978634880 4:110792687-110792709 AGGAGAGGGGAAATGAAGAAAGG + Intergenic
979573173 4:122253697-122253719 AAGAGAAGGTAGAGAAAGACGGG + Intronic
979796272 4:124850481-124850503 AGGAGATAGGAGTTCAACACAGG + Intergenic
979986508 4:127322596-127322618 AAGAGATAAGAGATAGAGACTGG + Intergenic
980182140 4:129414323-129414345 AGGAGAGAGGAGAGAAAGATCGG - Intergenic
982361046 4:154519505-154519527 AGGTAATGGGAGAAATAGACAGG - Intergenic
982753592 4:159191830-159191852 AGGAGATGTGAGGTCAAGAGAGG + Intronic
983675532 4:170288183-170288205 AGGAGAGAGGATATAAAAACAGG - Intergenic
983911424 4:173243870-173243892 AGAAAAGGGGAGATAAAGAATGG - Intronic
983913835 4:173269348-173269370 AGGAGGTGGAAGATAAAGTGGGG - Intronic
983946980 4:173597456-173597478 AGGAGCTGGGAGATGGAGAAAGG - Intergenic
984149798 4:176113133-176113155 GGTAGATGGGAGAAAAAAACAGG - Intronic
984488746 4:180405518-180405540 AAGAGATTGGACATAAAGGCAGG - Intergenic
987118364 5:14744466-14744488 AGGAGACAGGTGATAGAGACAGG + Intronic
987425206 5:17765436-17765458 TGGAGGTGAGAGAAAAAGACAGG - Intergenic
988051281 5:26034521-26034543 AAGAGATAGGAGATATAAACTGG - Intergenic
988995970 5:36715254-36715276 AGGAGTTGGGAGACAATGACGGG - Intergenic
989077656 5:37581434-37581456 AGGAGACAGGAGTTAAAAACAGG + Intronic
989196284 5:38719709-38719731 TGGAGTTGGGAGAGAAAGAATGG - Intergenic
989265012 5:39463469-39463491 AAATGATGGGAGATACAGACTGG - Intergenic
989313180 5:40044855-40044877 AGGAGAGGGGAGAGAAAGAGGGG + Intergenic
991621492 5:68549995-68550017 AGGAGTTGGGAGGTAAGAACAGG - Intergenic
993078558 5:83267595-83267617 AGGAGATGGGAAAGCAAGATAGG + Intronic
993404885 5:87499458-87499480 AGGAGAGGGGAGCTACAGAAGGG - Intergenic
993588634 5:89764823-89764845 AGGAGATGGGAGAAAAGTAATGG + Intergenic
994162521 5:96572643-96572665 AGGAGATGGAAGAAAAGGCCAGG - Intronic
995589538 5:113685179-113685201 AGGAGAGGGGAGATTCAGAAAGG + Intergenic
995687736 5:114789260-114789282 AGGAGATGGGAGATAGGTAGAGG - Intergenic
995691477 5:114830453-114830475 AGGAGTTGGGAGCTAAGCACTGG + Intergenic
996183014 5:120443028-120443050 AGGAAATGGGAGATAAAAGATGG + Intergenic
996566226 5:124881982-124882004 AGAAGATGAAAGAAAAAGACTGG - Intergenic
997294247 5:132759989-132760011 TGGAGAGAGGAGAGAAAGACTGG - Intronic
997665628 5:135627650-135627672 TGGAGATGGGAGAGAAATAAAGG - Intergenic
998511561 5:142718501-142718523 AGGGAATGGGAGATGAAGCCGGG - Intergenic
998522145 5:142810990-142811012 GGGAGATGGGAGGAAAGGACTGG - Intronic
998885735 5:146691969-146691991 AGGAGAGAGGAGATAGAGAATGG - Intronic
999499106 5:152128998-152129020 AGAAGATGGGATACAAAGATGGG - Intergenic
1000354275 5:160378548-160378570 TGGAGCTGGGAGATAAGGACGGG + Intergenic
1000989629 5:167898600-167898622 AGGAGCTGGGGGAGAGAGACTGG + Intronic
1002044980 5:176536741-176536763 AGGAGAGGGGAGATACGGCCCGG + Intronic
1002171012 5:177374233-177374255 AGGAGACGGTAGAAAATGACCGG - Intergenic
1004770258 6:18773205-18773227 AGGAGAAGGGAAATTAAGAATGG - Intergenic
1005178929 6:23081096-23081118 ATGATTTGGGAGATAAAGACTGG + Intergenic
1005494879 6:26379688-26379710 AGGAGAAGGGAGATACTCACTGG + Intergenic
1005504105 6:26455104-26455126 AGGAGAAGGGAGATACTCACTGG + Intergenic
1005528612 6:26678565-26678587 AGGAGTGGGGAGAAACAGACAGG + Intergenic
1005530656 6:26702053-26702075 AGGAGTGGGGAGAAACAGACAGG + Intergenic
1005540140 6:26799593-26799615 AGGAGTGGGGAGAAACAGACAGG - Intergenic
1005542184 6:26823083-26823105 AGGAGTGGGGAGAAACAGACAGG - Intergenic
1006387604 6:33740110-33740132 AGGAGATGTGGGCTGAAGACAGG - Intronic
1006392647 6:33767725-33767747 AGGAGATGGCAGCTGGAGACAGG + Intergenic
1006537738 6:34713714-34713736 AGTAGTTGTGAGATAAAGTCTGG + Intergenic
1006818991 6:36875429-36875451 AGAAAATAGGAGATAAAGAAAGG + Intronic
1007755675 6:44097691-44097713 AGGAGAAGGGAGAAAAAGAATGG - Intergenic
1007823413 6:44579176-44579198 TGGGGATGGGAGAGAGAGACAGG - Intergenic
1008142096 6:47843786-47843808 ATGAGATGTGAGAGAAAAACGGG - Intergenic
1008924063 6:56873719-56873741 CGGAGAGGGGAGATGAAGAGAGG + Intronic
1009012986 6:57865130-57865152 AGGAGTGGGGAGAAACAGACAGG - Intergenic
1009797877 6:68495233-68495255 GGGAGATGGGAGTTTAATACTGG - Intergenic
1011705826 6:90000768-90000790 AGGAGATGACAGCTAAAGAGCGG - Intronic
1011806643 6:91079868-91079890 AGGAGATGGGAGAGAGAAAGAGG - Intergenic
1012039966 6:94191612-94191634 AGGATAGAGGAGATAAAGAGAGG - Intergenic
1012272877 6:97236505-97236527 GGGAGATAGGAGAGAAAGAATGG + Intronic
1012445946 6:99307331-99307353 AAGAGATAAGAGTTAAAGACAGG + Intronic
1012574604 6:100777781-100777803 ATGAGATGGGAAAGAAAGACAGG + Intronic
1013752953 6:113428027-113428049 AGGAGAAGGGACAGAAAGAGGGG + Intergenic
1014222346 6:118810371-118810393 AGGAAATGGGATATACATACTGG - Intergenic
1014770665 6:125454600-125454622 AGGGGATGGGATAACAAGACTGG - Intergenic
1014940630 6:127434279-127434301 AGGAAATGGGAGATGAGGCCAGG + Intergenic
1015069218 6:129069611-129069633 AGGAGAGGGAAGATAATGACTGG + Intronic
1015369182 6:132431427-132431449 GGGAGAGGGGAGATGAAGAGAGG - Intergenic
1015510279 6:134031455-134031477 TGGAGATGGGGGATAAAAAATGG + Intronic
1015627666 6:135197618-135197640 ATCAGATGGGAGAAAAAGAAAGG - Intronic
1016063600 6:139655762-139655784 AGGAGAAGGGAAATATGGACAGG + Intergenic
1017062202 6:150494287-150494309 AGAAGAGGGGAGAAAAAGCCAGG + Intergenic
1017852949 6:158321410-158321432 AGGAGATGGCAGACAGAGAGAGG - Intronic
1018230445 6:161670233-161670255 AGGAGGTAGGAGATAATGAAGGG + Intronic
1019166436 6:170100523-170100545 AGGAGTTGGGAGCTCAAGGCAGG - Intergenic
1019217069 6:170451010-170451032 AGGAGAAGGAAGAAAAACACTGG - Intergenic
1019808775 7:3149082-3149104 AGGAGAAGGAAGAGAAAGAACGG + Intronic
1021392090 7:20105177-20105199 TGGAGATGTGAGATAAAGAAAGG + Intergenic
1021489104 7:21198961-21198983 AGGAGTTGGGAGATGAACCCAGG - Intergenic
1022125122 7:27349165-27349187 AGGAGAAGGGAGATAATCACGGG + Intergenic
1022575527 7:31493365-31493387 AGGAGATGGGAGCTAAGCAATGG - Intergenic
1023044003 7:36196377-36196399 GGGAGATGGGAGAGGGAGACGGG - Intronic
1023341077 7:39220432-39220454 AAGAGATGGGGGAAAAAGAGGGG + Intronic
1024680332 7:51680394-51680416 AGGAGATGGCAGAGAAGGAAGGG + Intergenic
1025224322 7:57143572-57143594 AGTAAGTGGGAGAGAAAGACGGG - Intergenic
1025231687 7:57207033-57207055 AGGAGATGGAAGATAAGGGAAGG - Intergenic
1026461855 7:70621328-70621350 AGGACATGGGAGAAAAAAAGGGG - Intronic
1028336044 7:89656714-89656736 AGGTGAAGGAAGATACAGACTGG + Intergenic
1028994736 7:97087177-97087199 GGGAGATGGGAGATCACCACTGG + Intergenic
1029370667 7:100148734-100148756 GGGAGATGGGTGTTAAAGAGGGG + Intergenic
1029833946 7:103289720-103289742 AGGAAATGGGAGATCAAGGTAGG + Intergenic
1029876828 7:103763238-103763260 GGGACATGGGAGGTACAGACTGG + Intronic
1030561708 7:111095132-111095154 AGGAGACGGGGAATAAAGAGGGG + Intronic
1030757829 7:113310683-113310705 CAGAGATGGGAGAAAAAGATAGG + Intergenic
1031575927 7:123415903-123415925 AGAAGAAAGGAGATAAAGACAGG - Intergenic
1031927004 7:127648375-127648397 AGGAGATGGGAGGGATACACAGG + Intergenic
1032545226 7:132736632-132736654 AGGAGAGGGGAGGTGCAGACGGG + Intergenic
1034043129 7:147900142-147900164 GGGTGATGGGAGAAAAACACAGG - Intronic
1034081250 7:148279629-148279651 AGGAGATGGGAGATAAAGACAGG - Intronic
1034328676 7:150262586-150262608 AGGAGATGTGAGATAAGGCAGGG + Intronic
1034764539 7:153706802-153706824 AGGAGATGTGAGATAAGGCGGGG - Intergenic
1035615095 8:993524-993546 TGGAGATGGGAGAGAAGAACAGG - Intergenic
1035783011 8:2243808-2243830 AGGAGATGGATGATAAGGCCTGG - Intergenic
1035809116 8:2475778-2475800 AGGAGATGGATGATAAGGCCTGG + Intergenic
1036086746 8:5620952-5620974 AAGAGGTAGGAGAGAAAGACAGG + Intergenic
1036776592 8:11617207-11617229 AGGAGAATGGAGATGAAGACGGG + Intergenic
1037130216 8:15399440-15399462 GGCAGATGGGAGAAAAAAACTGG - Intergenic
1037588283 8:20293099-20293121 AGGAGATACGAGATGAAGATAGG + Intronic
1037680397 8:21092546-21092568 AGGAGATTGGTGCCAAAGACTGG - Intergenic
1038285578 8:26203727-26203749 AGGAACTGGGATACAAAGACTGG - Intergenic
1038456010 8:27672351-27672373 TGGAGATGGGAGACAGAGGCAGG + Exonic
1038781015 8:30568586-30568608 AGGTGATGGGACGTCAAGACAGG - Intronic
1038834911 8:31108810-31108832 AGGAGAAGGGAGAGGAAGGCAGG + Intronic
1038980466 8:32753888-32753910 AGGGGCTGGGGGATAAAGAGGGG + Intronic
1038997001 8:32934685-32934707 AGGTGAAGGCAGATAAAGAATGG - Intergenic
1039176973 8:34819653-34819675 AGTAGATGGCAGAAAAACACTGG - Intergenic
1041710227 8:60887657-60887679 AGGAGATAGGAGCTTAAGTCAGG - Intergenic
1042027417 8:64438806-64438828 AGGAGAAGGGAGGTAAAAACAGG + Intergenic
1042406645 8:68413222-68413244 AGTAGATGAGAGATGAGGACTGG - Intronic
1042577709 8:70239186-70239208 AGGTGATGGGAGATCAAACCGGG + Intronic
1042642172 8:70948599-70948621 AGGAGACGGTAGACAAAGAGTGG - Intergenic
1043466197 8:80509717-80509739 ATGAGATGGGATTAAAAGACTGG - Intronic
1043476510 8:80610820-80610842 AGGGGGTGGAAGATAAAGAAGGG - Intergenic
1043497154 8:80814385-80814407 TGGAGATGGGGGATGCAGACAGG - Intronic
1043766561 8:84141239-84141261 AAGAGATTAGAGAGAAAGACAGG + Intergenic
1043849430 8:85199143-85199165 TGGAAAAAGGAGATAAAGACAGG - Intronic
1045619595 8:103959013-103959035 AGGGGATGAGAGATAAACACAGG - Intronic
1045884707 8:107081797-107081819 ATGAAATGTGAGATATAGACAGG - Intergenic
1047257377 8:123225412-123225434 ATGAGACTAGAGATAAAGACTGG + Intronic
1047637436 8:126779837-126779859 AGGAGAGGGGAGGAAAAGAGAGG + Intergenic
1047768593 8:128011698-128011720 AGGAGTTAGGAGGTAGAGACTGG + Intergenic
1048821774 8:138386867-138386889 ATGAGACGGGAGTTCAAGACAGG + Intronic
1048991869 8:139765261-139765283 AGGAGAAGGGAGGAAAAGCCAGG + Intronic
1049272725 8:141704521-141704543 AGGAGCTGGGGGATCAAGAGAGG + Intergenic
1050412766 9:5383622-5383644 GGGTGATGGGAGATAGTGACAGG + Intronic
1051193953 9:14542967-14542989 AGGAGATGGAGGAGAAAGAAGGG - Intergenic
1051477229 9:17521294-17521316 AGGAAATGGAACATAAAGAATGG + Intergenic
1051760195 9:20454770-20454792 GGAATATGGGAGATAGAGACAGG + Intronic
1052674771 9:31606539-31606561 AGGAGATGGGAGCTAAAGCCTGG - Intergenic
1054858997 9:69930617-69930639 AGCAGATGGGACATACTGACTGG - Intergenic
1055797697 9:79993311-79993333 AGGAGAAGGGAGAGAAAGAAAGG - Intergenic
1055895971 9:81176268-81176290 AAGAGATGGAAGATACACACTGG + Intergenic
1056083545 9:83122438-83122460 AGGAGGAGGGAGAAAATGACTGG + Intergenic
1056300288 9:85233259-85233281 TGGGGATGGAAGATAAAGAGAGG + Intergenic
1057016367 9:91656313-91656335 CGGAGATGGGAGATAGAGAATGG + Intronic
1058032188 9:100212600-100212622 AAGAGATGGGAGAAAAAAATAGG - Intronic
1058418128 9:104809145-104809167 AGGGGCTGGGAGAGAAAGAAAGG + Intronic
1058723370 9:107778932-107778954 AGGACATGGGACATAAAGAGAGG + Intergenic
1058756327 9:108086070-108086092 AGGAGAAGCGAGATGAAGAAAGG - Intergenic
1059716560 9:116918449-116918471 AAGAGCTGGGAGAGAAAGAATGG - Intronic
1060126063 9:121047826-121047848 AGGAGATGGCAGAAAATGAGAGG + Intronic
1060268633 9:122126566-122126588 AGGGGAAGGGAGACAGAGACGGG + Intergenic
1060330577 9:122665580-122665602 TGGGGTTGGGAGATAAAGGCTGG - Intergenic
1060775566 9:126371362-126371384 AGGAAATGGGAGATACACATAGG - Intronic
1061840285 9:133354813-133354835 GGGACATGGCAGGTAAAGACCGG - Exonic
1062248484 9:135582586-135582608 GGGTGATGGGAGACAATGACAGG + Intergenic
1062290942 9:135794067-135794089 AGGAGAAGGGAGAGAAAAGCCGG + Intergenic
1185604602 X:1360854-1360876 AGGGGAAGGGAGAGAGAGACAGG - Intronic
1185615640 X:1420101-1420123 GGGAGATGGGAGACAGAGACAGG - Intronic
1185630858 X:1514873-1514895 AGGGGAGGGGAGAGGAAGACAGG - Intronic
1185851095 X:3489404-3489426 AGGAGAAGGAAGATGAAGAGAGG + Intergenic
1185874956 X:3694537-3694559 AGGAGCTGGGAGATGCAGAAAGG + Intronic
1187858222 X:23657300-23657322 AGGGGAGAGGAGATGAAGACAGG + Intergenic
1188163120 X:26826961-26826983 AGGAAAAGGAAGATAAAGCCTGG - Intergenic
1188192009 X:27182814-27182836 AGGAAATGGGAGGCAAAAACGGG + Intergenic
1188902909 X:35757059-35757081 AGGAGGGGGGAGACAAAGAGAGG - Intergenic
1189326010 X:40111299-40111321 AGGAGATGCGAGGTTAAGAAGGG - Intronic
1190268692 X:48845675-48845697 ACGAGATGCGAGATAAGGCCAGG + Intergenic
1190605844 X:52140853-52140875 ATGAAATGGAAGAAAAAGACAGG + Intergenic
1190845248 X:54184677-54184699 GGAAGATGGGAGATAATGGCAGG + Intergenic
1191673976 X:63775987-63776009 AGTAGGGGGGAAATAAAGACAGG - Intronic
1191852813 X:65598397-65598419 AGGAGAGAGGAGAGAAAAACAGG + Intronic
1192033313 X:67538102-67538124 AGGAGGTGGGAGATACTGCCTGG + Intergenic
1192172887 X:68867750-68867772 AGGAGAGGGGAGATAATTACTGG - Intergenic
1192417643 X:70997723-70997745 AAGAGATGGGAGAGAGAGATAGG - Intergenic
1192695605 X:73412359-73412381 AGGAGATGGGAGTTGTAGAAAGG - Intergenic
1193456029 X:81732583-81732605 AGGAGATGGAGGAAAAAAACAGG + Intergenic
1193733176 X:85126131-85126153 AGCAGATTGGAGATACAGAAGGG - Intergenic
1194248127 X:91539222-91539244 AGGAGTTGGGAGCTGAACACTGG + Intergenic
1194467419 X:94250994-94251016 AGGAGATGAGGGATAAAAAGAGG + Intergenic
1195487950 X:105431782-105431804 AAGATATGGGAAATAAAGAGGGG + Intronic
1197572228 X:128163577-128163599 AGGAAATGGGAAAAAAACACAGG - Intergenic
1198311807 X:135432466-135432488 AGGAGAAGGGAGAGAAAGGGAGG - Intergenic
1198647965 X:138830089-138830111 AGAAAATGGGTAATAAAGACGGG + Intronic
1199510256 X:148613645-148613667 ATGTGATGGGAGATAAAGCTGGG - Intronic
1199988383 X:152968965-152968987 AGGAGAAGGGCCATCAAGACGGG + Intronic
1200136145 X:153875689-153875711 AGGAGGTAGAAGATAAAGAGGGG + Intronic
1200567141 Y:4780751-4780773 AGGAGTTGGGAGCTGAACACTGG + Intergenic
1200811636 Y:7491476-7491498 AGGAGAAGGAAGATGAAGAGAGG - Intergenic
1201474308 Y:14364206-14364228 AGGAGAAGGGAGAGGAAGACAGG + Intergenic