ID: 1034081252

View in Genome Browser
Species Human (GRCh38)
Location 7:148279642-148279664
Sequence TATCTGCCTGAGGAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034081252_1034081258 14 Left 1034081252 7:148279642-148279664 CCCATCTCCTCCTCAGGCAGATA 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 50
1034081252_1034081257 -3 Left 1034081252 7:148279642-148279664 CCCATCTCCTCCTCAGGCAGATA 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1034081257 7:148279662-148279684 ATAGATGTCTTGGCTTGACTAGG No data
1034081252_1034081259 15 Left 1034081252 7:148279642-148279664 CCCATCTCCTCCTCAGGCAGATA 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1034081259 7:148279680-148279702 CTAGGACATTGATCGTTACTGGG No data
1034081252_1034081260 20 Left 1034081252 7:148279642-148279664 CCCATCTCCTCCTCAGGCAGATA 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1034081260 7:148279685-148279707 ACATTGATCGTTACTGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034081252 Original CRISPR TATCTGCCTGAGGAGGAGAT GGG (reversed) Intronic
902830135 1:19007285-19007307 TATCTGTCGGAGGACGAAATGGG - Intergenic
903051375 1:20603700-20603722 TTTTTCCCTGAGGCGGAGATAGG - Intronic
903602621 1:24553745-24553767 TATCTGCCAGGGGAGGACAGGGG - Intergenic
903916430 1:26767964-26767986 TATGTGTCTGTGAAGGAGATTGG + Exonic
904441734 1:30536127-30536149 TGGCTTCCAGAGGAGGAGATGGG + Intergenic
904793805 1:33043853-33043875 TCTCTGGTTGAGGAGGAGTTTGG - Intronic
904916343 1:33973180-33973202 TATCTGCCTTAGGATGTGCTGGG + Intronic
906400183 1:45498876-45498898 TTTCTGCCTGGGGAGGTGACAGG - Intronic
907570440 1:55478280-55478302 TCGCTGCCTGCGGAGAAGATGGG + Intergenic
908340242 1:63171025-63171047 TTTCTGGCTGATGATGAGATGGG - Intergenic
909497967 1:76300707-76300729 TGTCTGCCTGGGGAGAAGGTGGG + Intronic
911415316 1:97564696-97564718 TATCTGCTTGATAAAGAGATTGG - Intronic
912341663 1:108921794-108921816 TACGGGCCTGAGGAGGAGAGAGG - Intronic
920176776 1:204106964-204106986 TATTTTACTGAGGAGGAAATGGG + Intronic
923862525 1:237905704-237905726 TTTCTGGTTGGGGAGGAGATTGG + Intergenic
924033246 1:239908619-239908641 CAGGTGCCTGAGGAGGAGCTGGG + Exonic
1065752758 10:28902769-28902791 TATCTGGCAGGGGAGGAGAATGG + Intergenic
1067773337 10:49143386-49143408 TAAGTGCCTGAGGTGGAGGTTGG + Intergenic
1068055350 10:52005909-52005931 TATCTGCCTGAGGAGGCCCTTGG + Intronic
1068087585 10:52393621-52393643 TATCTGCAAGAGGAAGAAATGGG - Intergenic
1069699271 10:70409317-70409339 TATCTGCCTGTGGAGGAGTGGGG + Intronic
1071580195 10:86762243-86762265 TATCTGGCAGAGGAAGACATAGG + Intronic
1072233317 10:93431541-93431563 TAGCAGCCTAAGTAGGAGATAGG + Intronic
1074100814 10:110353798-110353820 TATCTTCCTGCAGAGGTGATTGG + Intergenic
1074355854 10:112782425-112782447 TTTCTCCTTGAGGAGAAGATAGG + Intronic
1074449921 10:113550884-113550906 GAACTGGTTGAGGAGGAGATGGG - Intronic
1075167958 10:120086134-120086156 TATTTCCCTGTGGAGGAGCTGGG + Intergenic
1076756501 10:132575283-132575305 TTTCTGCCTGAGGGAGGGATTGG + Intronic
1078141910 11:8699208-8699230 GAGCTGCCTGTGGAGGAGGTGGG - Exonic
1079712800 11:23707893-23707915 TTTCTGCTTGAGGAGAAGAGAGG + Intergenic
1082124088 11:48411932-48411954 TATCTGCCTGAGGAGATTTTGGG + Intergenic
1083027441 11:59562568-59562590 TTTCAGCCTGAAGAGGAGAGGGG - Intergenic
1083035706 11:59635498-59635520 TTTTTTCCTGATGAGGAGATGGG - Intergenic
1084872079 11:72105159-72105181 GATCTGGATGAGGAGGAGAATGG + Intronic
1084906560 11:72352871-72352893 TATTTTACTGAGGAGGAGAGAGG + Intronic
1085015510 11:73171343-73171365 TTTCTGCCTCAGGAAGAGAGTGG + Intergenic
1085471683 11:76762601-76762623 TGACTGCATGAGGAGGGGATGGG - Intergenic
1086380586 11:86248289-86248311 GATTTGCCTTGGGAGGAGATGGG + Intronic
1088410943 11:109533860-109533882 TGAATGCCTGAGGAGGTGATGGG - Intergenic
1090228927 11:125088099-125088121 TACCTGCATGAAGAGGAGAGGGG - Exonic
1091339008 11:134795783-134795805 TATCTTCTGGAGGAGGAGAGGGG + Intergenic
1096121838 12:49093703-49093725 CATCTACCTGAGGAGGGGCTGGG - Intronic
1099153130 12:79140292-79140314 TATCTACCAGAAGAGGATATGGG - Intronic
1101788986 12:107911311-107911333 TATCTGCCTGATGATGAGGAGGG + Intergenic
1102095171 12:110233838-110233860 TATCTGCCTAAGGAGGCGCAGGG - Intergenic
1104100738 12:125606721-125606743 TTGCTGCCTGAGGAGGAGGCAGG - Intronic
1118107960 14:62682114-62682136 TCTCAGCCTGTGGAGGAGCTGGG - Intergenic
1120511058 14:85414908-85414930 AATATGCGTGAGGAGGAGAGTGG + Intergenic
1121600496 14:95199716-95199738 GCTCTGCCTGGGGAGGAGGTCGG + Intronic
1121974931 14:98394120-98394142 TGTTTGCCTGAGGATGAGCTTGG + Intergenic
1121988514 14:98531254-98531276 TTTCTACCTGAGGAGGAGGTGGG + Intergenic
1124188776 15:27553266-27553288 GAGCTGCCTGAGTAGGAGAGAGG - Intergenic
1124627097 15:31314432-31314454 CATCTCCCTGAGGAGGTGACTGG + Intergenic
1126440487 15:48683245-48683267 CTTCTGCCTGAGGAGAAGAGAGG + Intergenic
1126445434 15:48738386-48738408 TATCAGCCTTATGACGAGATGGG + Exonic
1128309282 15:66620468-66620490 TTTCTGCCTGGGGAGGAGGAGGG + Intronic
1128605919 15:69036778-69036800 TATCTGCCTGGGGAGGTTCTGGG - Intronic
1129233399 15:74209139-74209161 TCTGTGCCTGAGCTGGAGATGGG - Intronic
1132932768 16:2467415-2467437 TGTCTGCCTCAGGAGGACAGGGG + Intergenic
1135279087 16:21138424-21138446 TAACTGCCTGAGGAGGGGCCTGG - Intronic
1136188319 16:28600968-28600990 TTTCTCCCTGGGGAGGAGAACGG + Intergenic
1136190791 16:28613962-28613984 TTTCTCCCTGGGGAGGAGAACGG + Intronic
1136412520 16:30085642-30085664 CATTTTCCTGAAGAGGAGATGGG + Intergenic
1136430674 16:30194724-30194746 CATCTCCCTGAGGAGGAGAACGG - Exonic
1136508633 16:30722502-30722524 TATCAGCCTGAGGAGGGCAGAGG - Intronic
1136518134 16:30780134-30780156 TTTCTGGCTAAGGAGGAGAGGGG + Exonic
1137738069 16:50739806-50739828 TATCTGCCAGGGGATAAGATGGG - Intergenic
1137844846 16:51677233-51677255 TGTCTGCCTAAGGAGGATTTAGG + Intergenic
1139777246 16:69324170-69324192 TATGTGCCTGAGCAGGAGCCAGG - Intronic
1140119347 16:72070175-72070197 TATCTCTCTGAGGAGCAGTTCGG - Intronic
1141878920 16:86845335-86845357 TATGTGCCACAGGAGGAGTTTGG - Intergenic
1141899675 16:86982978-86983000 TATTTGCTTGAGAAGGAGAGTGG - Intergenic
1142765650 17:2062834-2062856 TTTCAGCCTGGGGAGGAGTTTGG + Intronic
1142765819 17:2063704-2063726 TTTCAGCCTGGGGAGGAGTTTGG + Intronic
1144643496 17:16952691-16952713 TTTCTGTCTGAGGAGCAGAGAGG + Intronic
1145832181 17:27925273-27925295 CATTTGGCTGAGGAGGAGACTGG + Intergenic
1147229897 17:39009925-39009947 TATCTGCCTGCTGAGCTGATAGG - Intergenic
1148443144 17:47722067-47722089 TTTCTGCCTGAGGAGGGAAGGGG - Intergenic
1150307179 17:64095690-64095712 TATCTGACTGAACAGGAAATTGG - Intronic
1150871014 17:68911039-68911061 TTTCTGCCTGAGGAAAAGAGAGG + Intronic
1154388684 18:13918060-13918082 GAGCTGCTTGAGGAGGAAATGGG + Intergenic
1155163430 18:23213839-23213861 CATCTGCCAGAGGAGGTGGTGGG + Intronic
1155296152 18:24386108-24386130 TAGGTGCCTGAGGAGGAGAGAGG + Intronic
1156651491 18:39231966-39231988 TGTCTGCCTGAGGATGACATGGG + Intergenic
1159584408 18:70269898-70269920 CATCTGCCTGCTGAGGAGAAAGG - Intergenic
1160437370 18:78862075-78862097 TTTCTTCCTGAGGATGAGAAAGG + Intergenic
1164832640 19:31334367-31334389 TATTTGCCAGAGGAGAAGATGGG - Intronic
1165938372 19:39403131-39403153 GATCTGAGGGAGGAGGAGATGGG + Intergenic
1166703428 19:44895258-44895280 GAGCTGCCAGAGGAGGAGAAGGG + Intronic
1167829303 19:52005933-52005955 TATATGCTTTAGGAGGATATAGG - Intronic
1168163285 19:54527308-54527330 CACCTGGCTGAGGAGGAGTTTGG - Intergenic
1168646671 19:58063431-58063453 TCTCTCCCTGAGCAGGACATTGG + Exonic
926105774 2:10149866-10149888 TATCTGCATGAGCAGGAGTGGGG - Intronic
926977088 2:18525961-18525983 TAGCTGCCAGAGGAGGAGGAAGG - Intergenic
927044433 2:19262805-19262827 TTTCTTCCTGTTGAGGAGATGGG - Intergenic
927257559 2:21053426-21053448 TCACTGCCAGAGAAGGAGATGGG + Intergenic
928227093 2:29459472-29459494 TTTCCGCCTGAGGATTAGATAGG - Intronic
929886558 2:45883846-45883868 TCTCTGCCTGGGGAGGGGCTTGG + Intronic
930236331 2:48892163-48892185 TAAGTACCTGAGGAGGAGAATGG - Intergenic
930716182 2:54596098-54596120 TAGCTGCGTGAGGAGGTGTTGGG - Intronic
931904960 2:66832411-66832433 TATCTGCCTGTAGAGCAAATGGG - Intergenic
932947986 2:76259830-76259852 TAACTGCCTGAGGCGAAGATGGG - Intergenic
933628721 2:84632354-84632376 TGCCTGGCTGAGGAGGAGAGTGG - Intronic
934861747 2:97769441-97769463 TTTCTGTCTGGGGAGGAGAGAGG + Intronic
935030964 2:99322375-99322397 TAGCTGCCTGATTACGAGATGGG + Intronic
935301511 2:101697541-101697563 TTCCTGCCTGAGGAGGAAAGGGG + Intronic
935372658 2:102364054-102364076 TAGCTGCCTGAGGAGGGGGGTGG + Intronic
939437551 2:142198417-142198439 TACCTGCATGAGTAAGAGATGGG - Intergenic
940051180 2:149466841-149466863 TGTCTGCATGAAGAGGAGACAGG + Intronic
940548040 2:155115281-155115303 TATCACCCTGAGACGGAGATTGG - Intergenic
941224073 2:162823042-162823064 TATCTACGTGAACAGGAGATGGG + Intronic
942037468 2:172024487-172024509 TATCTGCCTGGAGAGGTCATTGG - Intronic
943508134 2:188787801-188787823 TGTCTCCCTAAGGAGGAGAAGGG - Intronic
943735639 2:191351323-191351345 GATCTGGTTGAAGAGGAGATGGG + Intronic
947834873 2:233167887-233167909 TCTCTGCCTCAGGAGTAGCTGGG - Intronic
948212257 2:236203490-236203512 TATCTGCCTGAGAAGGAGGCTGG + Intronic
1169541979 20:6609602-6609624 TAAATGCTTGAGGAGGAGACAGG + Intergenic
1170869101 20:20188276-20188298 TATCTTCCTGAGAAGGATTTTGG - Intronic
1171240918 20:23566404-23566426 TATGTGCCTGGGGAGGGGTTTGG + Intronic
1173465266 20:43275968-43275990 TAACTGCCTGAGGTTGAGGTTGG + Intergenic
1176013248 20:62912004-62912026 CATCTGCCTGCGGAGGTGCTGGG - Intronic
1176131411 20:63498299-63498321 TCCCTGCCTGAGGAGGGGAGTGG - Intronic
1176523366 21:7844580-7844602 CATCTGCAAGAGGAGGAGAGAGG - Intergenic
1177751963 21:25295889-25295911 CATCTGCCTGGGGAGAAGACAGG + Intergenic
1177763419 21:25429207-25429229 TATCACCATGAGGAGGTGATAGG + Intergenic
1178657386 21:34474592-34474614 CATCTGCAAGAGGAGGAGAGAGG - Intergenic
1179273256 21:39867711-39867733 AATTAGCCTGAGGAGGAGAAAGG + Intronic
1183317302 22:37143723-37143745 CACCTGCCAGAGGAGGAGGTGGG + Intronic
1183366174 22:37408230-37408252 TATGTGCCTGATGATGAGAGGGG + Intronic
1184140988 22:42577311-42577333 TCTCTTCCTGGGGAGGAGTTGGG - Intergenic
949201040 3:1379684-1379706 TTTCTTCCTGAGGAGGAGGTGGG + Intronic
950554973 3:13689888-13689910 TTTCTGCCTGGGGTGGATATGGG + Intergenic
952133343 3:30389589-30389611 CATCTGCCTGAAGGGGAGAAGGG - Intergenic
952541030 3:34368172-34368194 TATCTGCAAAAGGAGGGGATAGG - Intergenic
954196703 3:49001418-49001440 TTTCTGCCAGAAGAGGAGGTGGG - Exonic
955133337 3:56191685-56191707 TAACTGGCTGGGGATGAGATTGG - Intronic
955523782 3:59800720-59800742 TATCTTCCTCAGGAAGAGAAAGG + Intronic
956716465 3:72084637-72084659 CATCAGCCTGAAGAAGAGATGGG + Intergenic
961667120 3:128499357-128499379 TATGTGTGTGCGGAGGAGATGGG - Intergenic
963447996 3:145439728-145439750 CTTCTGCCTGAGGAGAAGAGAGG + Intergenic
963723376 3:148889953-148889975 CATCAGTCTGAGGAGGAGCTCGG + Intronic
967117737 3:186356902-186356924 TCTCTTCCAGGGGAGGAGATGGG + Intronic
967118045 3:186359982-186360004 TCTCTTCCAGGGGAGGAGATGGG + Intronic
967961633 3:194929977-194929999 TCTCAGCCTGAGGAGTAGCTGGG + Intergenic
971503221 4:27338981-27339003 GCTCTGCCTGAGGAAGAAATGGG + Intergenic
971933882 4:33121257-33121279 TATCTTCCTGAGCAGAAGTTAGG - Intergenic
971958457 4:33453979-33454001 TCTCTGCATGAGGAGGAGGTTGG - Intergenic
972271132 4:37511601-37511623 TTTCTGCTTGAGGAGAAGAGAGG - Intronic
973918024 4:55656311-55656333 TGTCTTCCTGAAGAGGAGGTAGG - Intergenic
974486495 4:62512544-62512566 TGTCTGGCTGAGGAGGAATTTGG + Intergenic
977410047 4:96651304-96651326 TATGTGGGTGAGGAGGAGAAGGG + Intergenic
978880433 4:113695789-113695811 TATCTGTCTTAGGAGGCAATGGG - Intronic
982980825 4:162132789-162132811 TATCTTCTAGAGGAGGAGGTTGG + Intronic
983674894 4:170280910-170280932 TCTCTGGCTGGGGAGGAGCTTGG - Intergenic
986679523 5:10220743-10220765 TATGTCCCTGCGGAGGAGAAGGG + Intergenic
987937231 5:24481720-24481742 TCTCTGGTTGAGGAGGAGTTTGG + Intergenic
989635537 5:43528778-43528800 TTTCTTCCTAAGTAGGAGATGGG - Intronic
991195081 5:63922974-63922996 TATTTGCCAGATGAGGAAATTGG - Intergenic
991588334 5:68222377-68222399 TATCCCCCTAAGGAGGAGCTGGG + Intronic
994049549 5:95347061-95347083 TATATTCCAGAGGAGGAGGTAGG + Intergenic
995552693 5:113296157-113296179 ATTCTGCATGGGGAGGAGATGGG + Intronic
996196922 5:120619937-120619959 TTTCTGCCTGAGTTGGAGGTAGG + Intronic
997311977 5:132893841-132893863 TGTCTGGGGGAGGAGGAGATGGG - Intronic
997605971 5:135176236-135176258 TATCTGCCTGAGGAGGGCCTGGG + Intronic
997644419 5:135471706-135471728 TATCTGCCTCTGAAGGAGGTTGG + Intergenic
997884061 5:137615156-137615178 TATGTGACTGGCGAGGAGATGGG - Intergenic
998787749 5:145730785-145730807 TCTCTGGCTGGGGAGGAGTTTGG - Intronic
998851624 5:146356395-146356417 TTTCTCCCTGAAGAGGAAATGGG - Intergenic
999199982 5:149809103-149809125 TATCTATCTAAGGTGGAGATAGG - Intronic
999335154 5:150709392-150709414 TATTTGCCAGTGGAGGAAATGGG - Intronic
999763224 5:154718890-154718912 TATCTGTGTAAGAAGGAGATTGG - Intronic
999796370 5:154993308-154993330 TATCTGCCTGAGCATAATATTGG + Intergenic
999878184 5:155831803-155831825 GCTCTGCCTGATGAGGAGAATGG + Intergenic
1002279882 5:178123928-178123950 TGTCTGCCTGAGGAGGGAAAGGG + Exonic
1005632571 6:27722373-27722395 TATCTGCCTGATGAAGCCATGGG + Intergenic
1006217829 6:32460231-32460253 CATCTGCCTGAGGCGGAGGGAGG + Intergenic
1006896146 6:37472333-37472355 TATATGCAGGTGGAGGAGATAGG - Intronic
1007243134 6:40441500-40441522 AGTCTGCCTGAGGAAGAGAGAGG + Intronic
1008828597 6:55730441-55730463 TATATTCCAGAGGAGGAGAAAGG + Intergenic
1009888847 6:69656310-69656332 AACCTGCCTGGTGAGGAGATAGG - Intergenic
1013449495 6:110265702-110265724 TATATGCCAGGGGAGGAGGTAGG + Intronic
1013627644 6:111953384-111953406 TCTCTGCCAGAGGATGAGCTTGG + Intergenic
1013720810 6:113026018-113026040 TATCTCCCTGAGCTGGGGATTGG - Intergenic
1015017262 6:128428537-128428559 TACCTCCCTGAGGAGGAACTAGG + Intronic
1018223524 6:161605891-161605913 TATCAGCCAGAGGAGAAAATAGG + Intronic
1018455265 6:163946094-163946116 TGGCTCCCTGAGGAGGAGCTGGG + Intergenic
1018987794 6:168650764-168650786 TACCTGCCTGACGAGGAGGAGGG - Exonic
1019451460 7:1100810-1100832 TCTCTGCCTGTGGGCGAGATGGG - Intronic
1020003409 7:4768527-4768549 CCTCTGCCTGAGGAGGAGCTGGG - Exonic
1021613855 7:22482614-22482636 TATGTGCCTGGGGGGCAGATTGG - Intronic
1021636373 7:22698118-22698140 TATTGGCCTGAGGGAGAGATGGG - Intergenic
1022411309 7:30140580-30140602 TATCTGACAGAGGAGGAAACAGG - Intronic
1026735405 7:72945739-72945761 CATCTGTCTGAGGAGGGGTTGGG + Intronic
1028018150 7:85740413-85740435 TATCTTTCTGAGGAGCAGTTTGG + Intergenic
1028358194 7:89935194-89935216 TCTCTCCCTGAGGAAGGGATAGG - Intergenic
1028438936 7:90837008-90837030 TATTTTCCTGAGAAGGAGACTGG - Intronic
1030077489 7:105748998-105749020 TATCTGCATGAGGAGAAGGAAGG + Intronic
1030289121 7:107854993-107855015 TCTGTGCCTGACGAGGAGTTTGG - Intergenic
1030353668 7:108519802-108519824 CTTCTCCCTGAGGAGGAGAAGGG - Intronic
1033987477 7:147244023-147244045 TTTCTGCCTGAGGTGGAGGTGGG + Intronic
1034081252 7:148279642-148279664 TATCTGCCTGAGGAGGAGATGGG - Intronic
1035581425 8:741956-741978 CATCTGTCTGTGGAGGAGAAGGG + Intergenic
1038057739 8:23876935-23876957 GATATGCCTGAGGAGCAGTTGGG + Intergenic
1038409439 8:27346722-27346744 TTTCTCCATGAGGAGGAGTTTGG - Intronic
1039193817 8:35007546-35007568 TCTCTGACTGAGGAAGAGGTGGG + Intergenic
1042102510 8:65288699-65288721 GATCTGCCTGAGAAGGATGTAGG - Intergenic
1046214909 8:111131440-111131462 TATCTACCTGAGGAGAATCTGGG - Intergenic
1051390360 9:16557018-16557040 TATCTGACTGTGGAGGAGTCAGG + Intronic
1052856108 9:33407713-33407735 TCTCTGGCTGAGCAGGAGAGTGG - Intergenic
1052952213 9:34221815-34221837 TATCTGCCTTTGGAGGGGAATGG + Intronic
1056436321 9:86578606-86578628 TCTCGGCCTGAGGGGGAGAGCGG + Intergenic
1058522862 9:105829044-105829066 TTTCTGCTTGAGGAGAGGATGGG - Intergenic
1058835371 9:108855119-108855141 TTCCTGCCCGAGGAGGAGCTGGG - Exonic
1060338923 9:122755545-122755567 TATCTGCCTGAGCTGAAAATGGG + Intergenic
1062632071 9:137467557-137467579 TCTCTGCCTGTGGAGGAGTTGGG - Intronic
1188728967 X:33622426-33622448 TATCTACCTGAGGAGGGGTCAGG + Intergenic
1189996717 X:46646260-46646282 GACCTGCTTGAGTAGGAGATAGG - Intronic
1190059104 X:47199483-47199505 TACCTGCGGGAGGAGGACATCGG + Exonic
1190721951 X:53156038-53156060 TCTCTGGTTGAGGAGGAGTTCGG + Intergenic
1191879290 X:65828495-65828517 TTTCTGTCTGAGTAGGAGCTGGG + Intergenic
1194135731 X:90138459-90138481 TCTCTGCCTGGGGAGGAGTTTGG + Intergenic
1195543027 X:106084966-106084988 TATCAGCCTGAGGAGAATTTGGG - Intergenic
1195602769 X:106767592-106767614 TATCAGCCTGAGGAGAATTTGGG + Intronic
1197713912 X:129692337-129692359 AAGCTGCCTGAAGAGGACATGGG + Intergenic
1197783077 X:130175876-130175898 TATCTGCAAGAGGAGGACACTGG - Intronic
1197952088 X:131908365-131908387 TATCAGCCAGAGTAGGAGAGAGG + Intergenic
1199505096 X:148552476-148552498 TATCCACCTGGGGAGGATATTGG + Intronic
1199600592 X:149539404-149539426 GAGCTGCCGGAGGAGGAGCTGGG - Intergenic
1199996677 X:153030523-153030545 TATTTGCCTGGGGAGGATTTGGG - Intergenic
1200481493 Y:3708526-3708548 TCTCTGCCTGGGGAGGAGTTTGG + Intergenic