ID: 1034081254

View in Genome Browser
Species Human (GRCh38)
Location 7:148279649-148279671
Sequence AGACATCTATCTGCCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034081254_1034081260 13 Left 1034081254 7:148279649-148279671 CCTCCTCAGGCAGATAGATGTCT 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1034081260 7:148279685-148279707 ACATTGATCGTTACTGGGAAAGG No data
1034081254_1034081257 -10 Left 1034081254 7:148279649-148279671 CCTCCTCAGGCAGATAGATGTCT 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1034081257 7:148279662-148279684 ATAGATGTCTTGGCTTGACTAGG No data
1034081254_1034081259 8 Left 1034081254 7:148279649-148279671 CCTCCTCAGGCAGATAGATGTCT 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1034081259 7:148279680-148279702 CTAGGACATTGATCGTTACTGGG No data
1034081254_1034081258 7 Left 1034081254 7:148279649-148279671 CCTCCTCAGGCAGATAGATGTCT 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034081254 Original CRISPR AGACATCTATCTGCCTGAGG AGG (reversed) Intronic
902976933 1:20095547-20095569 TGACATGTATTTGCCTTAGGGGG + Intergenic
903602625 1:24553752-24553774 AGAAACCTATCTGCCAGGGGAGG - Intergenic
904411522 1:30327846-30327868 ACCCATCTCACTGCCTGAGGTGG - Intergenic
906028586 1:42697771-42697793 AGACAACTATCTACTTGAGTGGG + Intronic
909026974 1:70493522-70493544 AGACATCTTTTTGCCTGACTAGG - Intergenic
914224733 1:145711081-145711103 AGCCATGTTTCTGCCTGAGGGGG - Intergenic
914682601 1:149949734-149949756 AGGAATCTATCTGCCTTTGGAGG - Exonic
916773597 1:167936895-167936917 AGACATGGCTCTGCCTGAGCCGG - Exonic
920034659 1:203058185-203058207 AGACAGCTAGCTGGCTGAGGAGG + Intronic
922326326 1:224531755-224531777 AGACATCCAAGTGACTGAGGTGG + Intronic
923086695 1:230707986-230708008 ACACATCTAGCTGCCTGCTGAGG + Intronic
1063053069 10:2474603-2474625 AGTCATGGATCTGCCTGAGGTGG - Intergenic
1067127141 10:43528239-43528261 AGACATCTGTCTGGGTGCGGTGG - Intergenic
1070149656 10:73797917-73797939 ACACATCCATCTTCCTCAGGGGG + Exonic
1070355939 10:75640282-75640304 AAACATCTACCTGCCTAATGGGG - Intronic
1071946641 10:90653302-90653324 AAACATCTCTCTGGCTGAGGTGG - Intergenic
1075428663 10:122362783-122362805 GGACATCTGTCTGCCACAGGGGG + Intergenic
1083049495 11:59764509-59764531 ATACATCTGACTGCCTGAGTTGG + Intronic
1083608089 11:63991041-63991063 GGAAATCTAGCTCCCTGAGGAGG - Intronic
1087307962 11:96506422-96506444 AGGCGTCTATCTGCCTTTGGAGG - Intronic
1090829978 11:130414548-130414570 AGGCAGCTGTCTACCTGAGGAGG - Exonic
1090910220 11:131111813-131111835 AGACATCTCTGAGCCTGTGGGGG + Intergenic
1099047362 12:77738047-77738069 AGACATCTAGAAACCTGAGGAGG - Intergenic
1101360422 12:104021176-104021198 AGATAGCTTTCTCCCTGAGGGGG - Intronic
1106003105 13:25743261-25743283 AGACATCTTTCGGCCTCTGGTGG - Intronic
1107914384 13:45134372-45134394 TGCCATCTTGCTGCCTGAGGTGG + Intronic
1110110437 13:71738442-71738464 AGAAAACTGTCTGCGTGAGGTGG + Intronic
1113093349 13:106637467-106637489 AGTGCTCTATCTGCCTGTGGTGG + Intergenic
1118758793 14:68864952-68864974 AGACATCTATGAGCATGGGGAGG - Intergenic
1122326842 14:100885913-100885935 AGACATGTATCTGGCAGAGTTGG + Intergenic
1122906327 14:104803265-104803287 AGACATCTGGCCGCCTCAGGAGG - Exonic
1123501880 15:20893713-20893735 AGGCATCTTTCTACCTGAGGAGG - Intergenic
1123559133 15:21467412-21467434 AGGCATCTTTCTACCTGAGGAGG - Intergenic
1123595364 15:21904693-21904715 AGGCATCTTTCTACCTGAGGAGG - Intergenic
1124033440 15:26031884-26031906 AGACTTTTATCTGCATGACGAGG - Intergenic
1127372883 15:58356916-58356938 CCACCTCTATCTGCCAGAGGGGG - Intronic
1128874415 15:71190483-71190505 TGACAGCTATCGGACTGAGGGGG + Intronic
1129056045 15:72821366-72821388 AGACATCTCTCATCCTGGGGTGG - Intergenic
1130928183 15:88400591-88400613 TGACATCTAGCTGGGTGAGGTGG - Intergenic
1202967481 15_KI270727v1_random:194571-194593 AGGCATCTTTCTACCTGAGGAGG - Intergenic
1135789260 16:25378439-25378461 TAAGATCTATCTGCATGAGGTGG + Intergenic
1136508635 16:30722509-30722531 AAGCAGCTATCAGCCTGAGGAGG - Intronic
1140411323 16:74742324-74742346 ATACGGCTGTCTGCCTGAGGGGG + Intronic
1148854435 17:50570982-50571004 AGAGATCTGTCTGCTTGACGAGG + Intronic
1150413509 17:64967277-64967299 ACACATCTATCTAGCAGAGGTGG + Intergenic
1150798312 17:68257906-68257928 ATACATCTATCTAGCAGAGGTGG - Intergenic
1155528403 18:26741113-26741135 AGGCATCTATCTGCATGAATGGG - Intergenic
1155936988 18:31764340-31764362 AGACATTTAGCAGCCTGAGAAGG - Intergenic
1158031578 18:52971760-52971782 TGACTTCTCTCTGCCTTAGGAGG - Intronic
1159003997 18:62996848-62996870 AGCCATCTCTGTTCCTGAGGTGG - Intergenic
1161908418 19:7174809-7174831 AGGCATCTTTCTGCCTGATATGG + Intronic
1164356804 19:27444428-27444450 AGACATTTACCTGTGTGAGGTGG - Intergenic
925674553 2:6347141-6347163 AGTCATCACTCTGCCTGATGAGG - Intergenic
929161302 2:38835151-38835173 AGAAATGTATCTGCCTGAAAAGG + Intronic
929757706 2:44781173-44781195 AGAATTCTAACTCCCTGAGGTGG - Intergenic
935372653 2:102364047-102364069 AAGCTTCTAGCTGCCTGAGGAGG + Intronic
938074885 2:128326511-128326533 AGGCATCTTTTTGCCTCAGGCGG - Intergenic
939772994 2:146347410-146347432 AGACATCTGTCTTTGTGAGGAGG + Intergenic
944014842 2:195023031-195023053 AAACTTCTATCTGACTTAGGAGG - Intergenic
946082131 2:217130246-217130268 ACACATCCATGTGCCAGAGGGGG - Intergenic
947511256 2:230756427-230756449 AGTCATGTAGCTGCCTGATGAGG - Intronic
948502446 2:238405363-238405385 AGACAGCCAGCTGCCAGAGGGGG - Intergenic
1169108395 20:3016895-3016917 ACACGTCTGTCTGACTGAGGGGG - Intronic
1172909043 20:38392658-38392680 CGACATCCAGCTGGCTGAGGGGG - Intergenic
1174859296 20:54075379-54075401 AAGTATCTATTTGCCTGAGGAGG + Intergenic
950187420 3:10953667-10953689 AGACAGGTATCTGCTGGAGGGGG + Intergenic
950924655 3:16728475-16728497 ACACTTCTATCTGCCTCTGGAGG - Intergenic
955079279 3:55642915-55642937 ATGCATCTATCTGCCTAAAGAGG + Intronic
956214071 3:66830253-66830275 ACACATTTATCTGCTTGGGGAGG + Intergenic
958824464 3:99013751-99013773 AGATCAGTATCTGCCTGAGGTGG - Intergenic
959439442 3:106358685-106358707 AGACATTTGTGTGCCAGAGGAGG + Intergenic
959527751 3:107396888-107396910 AGACCCCAATTTGCCTGAGGTGG - Intergenic
960127011 3:114010810-114010832 AGGCATCAGTCTACCTGAGGAGG - Exonic
963029806 3:140958196-140958218 AAACATCTATCTGCTTAAGAGGG - Intronic
964665284 3:159165223-159165245 AGACATTTATTTGCCTCATGAGG - Intronic
965125964 3:164629177-164629199 AGAGGTCAATCTTCCTGAGGTGG - Intergenic
966048057 3:175577446-175577468 ACACATTTATCAGGCTGAGGAGG + Intronic
966781264 3:183586312-183586334 AGACATTTTTCAGCCTTAGGAGG + Intergenic
967213195 3:187187070-187187092 AGTCATCTCTCTTCCTGAGCAGG + Intergenic
971314094 4:25552812-25552834 AGACTTCTATTTGGCTGATGGGG - Intergenic
975254421 4:72216586-72216608 AGACATCTCTGAGCCTGTGGGGG + Intergenic
978993294 4:115114828-115114850 AGACACCCATATACCTGAGGAGG - Intergenic
987860206 5:23476440-23476462 AGACTTCTGTCTACCTGATGAGG - Intergenic
992259970 5:74959634-74959656 GAACATCTATCAGCCAGAGGAGG + Intergenic
993184112 5:84593804-84593826 AGAGATCTTTCTACCTGAGAAGG - Intergenic
993971984 5:94430966-94430988 GGACATCTTTGTGCCTGAGAAGG - Intronic
995029571 5:107464910-107464932 AGCCATCCCTCTGCCTGAAGAGG + Intronic
995053593 5:107734511-107734533 AGACTTCCATCAGCCTGTGGTGG + Intergenic
995542144 5:113195939-113195961 AAACATCCTTCTCCCTGAGGGGG - Intronic
1000409917 5:160927553-160927575 AGATGTTTATCTTCCTGAGGTGG + Intergenic
1005774640 6:29117369-29117391 AGACATCTGTCTGAATGGGGAGG - Intergenic
1006793284 6:36717264-36717286 AGATTTCCATCTGCCTGGGGAGG - Exonic
1007124017 6:39409475-39409497 AGTCATCTACCTGCCAGAAGGGG + Intronic
1011339368 6:86296047-86296069 AGACATCTATGTGACAGAGTAGG - Intergenic
1017749048 6:157472340-157472362 AGACATTTATCTCCATGTGGAGG + Intronic
1017749056 6:157472375-157472397 AAACATTTATCTCCCTGTGGAGG - Intronic
1022779180 7:33560720-33560742 AAACATCTATCTTTCTGGGGTGG - Intronic
1024353662 7:48393307-48393329 AGCCATGCATCTTCCTGAGGGGG - Intronic
1026294168 7:69036588-69036610 AGACATTTGGCTGCCTCAGGAGG + Intergenic
1026294252 7:69037464-69037486 AGACATTTGGCTGCCTCAGGAGG - Intergenic
1027341717 7:77215645-77215667 AGACATCTATAAGACTGAAGAGG - Intronic
1027657674 7:80951313-80951335 AGAAATCTATCTCCCTGAGCTGG + Intergenic
1028110603 7:86935917-86935939 AGATTTCTTTCTGCCTGTGGGGG - Intronic
1034081254 7:148279649-148279671 AGACATCTATCTGCCTGAGGAGG - Intronic
1037944199 8:22976264-22976286 CGTCAGCTCTCTGCCTGAGGTGG - Intronic
1038029477 8:23624585-23624607 AGACATCTGTCTACCTGGTGAGG - Intergenic
1044499711 8:92939575-92939597 GGACATCTCTTTGCCTGGGGAGG - Intronic
1044633226 8:94298888-94298910 AGACATTTGTGTGCCAGAGGAGG - Intergenic
1045640100 8:104240051-104240073 ATACTTCTCTCTGCCTGAAGAGG - Intronic
1045872030 8:106938136-106938158 AGACATCCATTTTCCAGAGGTGG + Intergenic
1046566817 8:115912295-115912317 ATAAATCTATATGCCTAAGGTGG + Intergenic
1051464161 9:17357350-17357372 AGTGATATATCTGCCTGTGGAGG - Intronic
1056282143 9:85051934-85051956 AGTCATATCTCTGCCTGTGGTGG - Intergenic
1188939623 X:36220653-36220675 AGAAATTTATCTGTCTTAGGTGG - Intergenic
1189601013 X:42626287-42626309 AGACTTCTACCTGCTTTAGGAGG + Intergenic
1194586069 X:95735855-95735877 AGACAGCTTTCTGCCTTATGAGG + Intergenic
1195953280 X:110301388-110301410 AGCACTGTATCTGCCTGAGGTGG - Intronic
1198949007 X:142048491-142048513 AGAAAACTATCTCCCTGATGTGG + Intergenic