ID: 1034081255

View in Genome Browser
Species Human (GRCh38)
Location 7:148279652-148279674
Sequence CCAAGACATCTATCTGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034081255_1034081258 4 Left 1034081255 7:148279652-148279674 CCTCAGGCAGATAGATGTCTTGG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 50
1034081255_1034081260 10 Left 1034081255 7:148279652-148279674 CCTCAGGCAGATAGATGTCTTGG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1034081260 7:148279685-148279707 ACATTGATCGTTACTGGGAAAGG No data
1034081255_1034081259 5 Left 1034081255 7:148279652-148279674 CCTCAGGCAGATAGATGTCTTGG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1034081259 7:148279680-148279702 CTAGGACATTGATCGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034081255 Original CRISPR CCAAGACATCTATCTGCCTG AGG (reversed) Intronic
904545680 1:31269271-31269293 CCAAAACAACTATCGGCCAGAGG + Intronic
908774410 1:67626278-67626300 CTAAGACATCTTCCTGCCTCAGG + Intergenic
909666113 1:78135056-78135078 GGAAGACATCTGTCTACCTGTGG - Intronic
909819959 1:80049796-80049818 CCAAGGCATGTATCTGACTAGGG - Intergenic
913280642 1:117181882-117181904 TCAGGCCATCCATCTGCCTGAGG - Intronic
915643351 1:157247460-157247482 ACAAGGCATGTTTCTGCCTGAGG + Intergenic
917037616 1:170766114-170766136 GTAAGATGTCTATCTGCCTGGGG - Intergenic
917841032 1:178978063-178978085 CCAATACATCTGTCTGACAGTGG + Intergenic
918171258 1:181999478-181999500 CCAAGAGATCCACCTGCCTTGGG + Intergenic
922444519 1:225685267-225685289 CCAGGAAATTTATCTGCCTAGGG - Intergenic
1062980251 10:1716247-1716269 CTAAAGCATCTTTCTGCCTGGGG - Intronic
1070057397 10:72948904-72948926 CCAAGAGCTCTACCTGCCAGCGG + Intronic
1072356674 10:94618290-94618312 CCAAGGTATTTAGCTGCCTGGGG + Intergenic
1072599641 10:96913685-96913707 CCAAGTGATCTGCCTGCCTGAGG - Intronic
1074040833 10:109786643-109786665 CCTAGAGATGTTTCTGCCTGTGG - Intergenic
1083312163 11:61789537-61789559 CCAAGGCCTCGATCTGCCTTTGG - Intronic
1087307963 11:96506425-96506447 CAAAGGCGTCTATCTGCCTTTGG - Intronic
1087324961 11:96710474-96710496 CCAATACAGCTGCCTGCCTGGGG - Intergenic
1088950132 11:114560368-114560390 CCAAGCCATCCTTCTGCCTTGGG + Intergenic
1093050249 12:14496058-14496080 CCAAGCTATCAATCAGCCTGTGG - Intronic
1095828271 12:46553633-46553655 TCAAGACACCTACCTGCCTGGGG - Intergenic
1100244696 12:92745555-92745577 CAAAGTCATCTCTCTGCCTCAGG - Exonic
1102751801 12:115301115-115301137 CCAAGGCATCTGTCTGTCTCTGG + Intergenic
1106699839 13:32217571-32217593 CCAAGGCCTCTACCTCCCTGGGG - Intronic
1108036837 13:46298935-46298957 ATAAGAAATCTATTTGCCTGGGG - Intergenic
1113443520 13:110347781-110347803 CCCAGACATTGAGCTGCCTGAGG + Intronic
1115822766 14:37229378-37229400 TCAAGTGATCTATCTGCCTTTGG + Intronic
1116708220 14:48330780-48330802 CCAAGAAAATTATTTGCCTGAGG + Intergenic
1123921169 15:25070872-25070894 TCAAGACAAAGATCTGCCTGAGG - Intergenic
1125258508 15:37795116-37795138 CAGAGCCATCTATCAGCCTGGGG - Intergenic
1126340468 15:47635479-47635501 TTAAGACATCTGTCTGGCTGGGG - Intronic
1126357361 15:47810811-47810833 CCATGAGGACTATCTGCCTGTGG - Intergenic
1126774718 15:52090590-52090612 TCAAGACATTTATCTACCTCAGG - Intergenic
1127851045 15:62911984-62912006 GCAAGGCAGCCATCTGCCTGTGG + Intergenic
1128700687 15:69801856-69801878 CCAAGACATCCATCTGAATCTGG - Intergenic
1129920089 15:79312146-79312168 CTCAGACAGCTATCTGCTTGTGG + Intronic
1135938933 16:26804083-26804105 CCAAAACACTTATATGCCTGAGG + Intergenic
1140326268 16:74005978-74006000 CAAAGGCAGCTACCTGCCTGGGG - Intergenic
1143805714 17:9424461-9424483 CCAGGCCCTCTCTCTGCCTGGGG + Intronic
1143982582 17:10882785-10882807 CCAAGACATCTACCACCCTCAGG - Intergenic
1144387283 17:14760643-14760665 CCAATAGATCTATCAGTCTGAGG - Intergenic
1147122319 17:38343125-38343147 CCCACATATCCATCTGCCTGCGG + Exonic
1147641299 17:42002331-42002353 CGAAGACATCTAGGTACCTGGGG + Intronic
1147942700 17:44060773-44060795 CCAAGAGCTATATCTACCTGAGG + Intronic
1148977193 17:51539820-51539842 CCAAGCCATCTTTAAGCCTGAGG + Intergenic
1150206962 17:63416382-63416404 CTCTGACATCTACCTGCCTGAGG + Intronic
1154256720 18:12787913-12787935 CCAAGTCAGCTCTATGCCTGAGG + Intronic
1154334814 18:13456937-13456959 CCAGGATTTCTGTCTGCCTGGGG + Intronic
1154946515 18:21166938-21166960 CCAATTCATCTAGCTCCCTGAGG + Intergenic
1154966191 18:21359071-21359093 CCAAGACACCTATCTTCCCTGGG - Intronic
1158405694 18:57157432-57157454 GCAAGAAATATAGCTGCCTGGGG - Intergenic
1162825030 19:13245994-13246016 CCAAGCCACTCATCTGCCTGAGG + Intronic
1165131916 19:33638009-33638031 GCAAGAAATCTATCTCCTTGGGG - Intronic
1165358708 19:35320274-35320296 CCTAGAGCTCGATCTGCCTGGGG + Intronic
1167094955 19:47370285-47370307 CCAAGACTTCTTTCTGCGTTTGG - Intronic
926317759 2:11724128-11724150 CCAAGCCTTCTATCGGCCTCTGG + Intronic
928365848 2:30701633-30701655 ACAAGATAACTGTCTGCCTGAGG - Intergenic
930496487 2:52151191-52151213 CCAATACCTCTATTTCCCTGAGG - Intergenic
932054481 2:68430882-68430904 CCTAGTCATCTACCTGCATGGGG - Intergenic
934581572 2:95445247-95445269 TCAAGTGATCTGTCTGCCTGGGG + Intergenic
934597878 2:95631467-95631489 TCAAGTGATCTGTCTGCCTGGGG - Intergenic
935124112 2:100207804-100207826 CCATGTCATCTCTCTGCCTCTGG + Intergenic
935227006 2:101061567-101061589 CCCAGGCTTCTCTCTGCCTGAGG + Intronic
935372652 2:102364044-102364066 CCAAAGCTTCTAGCTGCCTGAGG + Intronic
936564026 2:113568786-113568808 CGAAGACAACCATCTGGCTGGGG + Intergenic
936948288 2:117951094-117951116 CTAAGACATTTATATGCCTTAGG - Intronic
938485730 2:131705810-131705832 CCAAGAAGACTCTCTGCCTGTGG - Intergenic
941039943 2:160609859-160609881 TCAAGACATCCATCTGAGTGTGG - Intergenic
946065921 2:216987117-216987139 CCAAAAGACTTATCTGCCTGAGG + Intergenic
947219457 2:227778746-227778768 CCAAGGCATCTGTGAGCCTGTGG - Intergenic
947938914 2:234031463-234031485 CCAGGACCTCCATCTGCCTGAGG + Intergenic
1169639021 20:7727536-7727558 CCAAGAACTCTATCTGCCATTGG - Intergenic
1172787135 20:37475799-37475821 ATAAGACAAATATCTGCCTGTGG + Intergenic
1173178996 20:40787557-40787579 CAAAGACATGTTTCTCCCTGAGG + Intergenic
1179112529 21:38459826-38459848 CAAAGACACCTATCTGCATAAGG + Intronic
1181993836 22:26859251-26859273 TCAAGACATCCATCCCCCTGTGG - Intergenic
950794706 3:15501452-15501474 CAAAGACATCTACCTGTTTGGGG + Intronic
950924656 3:16728478-16728500 CAAACACTTCTATCTGCCTCTGG - Intergenic
952034955 3:29188973-29188995 CCAAGATATCTTTCTGGCTCAGG - Intergenic
955158252 3:56438983-56439005 CCAAGAAATCTATGGGCCAGTGG - Intronic
956038222 3:65118499-65118521 CCAAGCCATAAATCTGCCTGGGG + Intergenic
957368099 3:79252887-79252909 GCAAGACATCTATCTCCTTGAGG - Intronic
960298690 3:115975183-115975205 TCAAGCCATCCATCTGCCTCAGG - Intronic
961764203 3:129195697-129195719 TCAAAACATCTACCTGCTTGAGG + Intergenic
963061157 3:141228128-141228150 GCAAGATATTTATCTCCCTGAGG + Intergenic
963165804 3:142202137-142202159 CCTAGACCTCTTTCTCCCTGAGG - Intronic
974595398 4:64008143-64008165 CCCTGACATCCATCTCCCTGAGG - Intergenic
976661803 4:87547478-87547500 CAAAGACCTCTGTCTGGCTGAGG - Intergenic
977927675 4:102719327-102719349 CCATAACATCTGACTGCCTGTGG - Intronic
979656326 4:123198625-123198647 CCAAAACATCTTCCTGCCTTAGG + Intronic
982080609 4:151786089-151786111 CCAAGGTATCCATCTGCCTGGGG - Intergenic
982264558 4:153526432-153526454 CCAAGACAGCAAGCTTCCTGAGG - Intronic
982288374 4:153757638-153757660 CCAAAACTGCTCTCTGCCTGGGG - Intronic
984079384 4:175226227-175226249 CCAAGACTTCTTTCAACCTGGGG - Intergenic
988394099 5:30674678-30674700 CCTGGACATCTATTTGCCTTGGG + Intergenic
989446942 5:41541384-41541406 ACAGGACATCTTACTGCCTGAGG - Intergenic
989650367 5:43682044-43682066 TAAACACATCTAGCTGCCTGTGG + Intronic
1000409916 5:160927550-160927572 CCAAGATGTTTATCTTCCTGAGG + Intergenic
1004200810 6:13546260-13546282 TCAAGCCATCTTTCTGCCTAGGG - Intergenic
1006950717 6:37819588-37819610 ACAGGACATCTCTCTGGCTGGGG + Exonic
1009638258 6:66295532-66295554 CCAAGGCACCTATGTGCCTTAGG - Intergenic
1009808062 6:68628092-68628114 CAGGGACATCTAACTGCCTGAGG + Intergenic
1010412170 6:75573025-75573047 CCAAGTGATCCATCTGCCTCAGG - Intergenic
1014747284 6:125214685-125214707 CTAAGGCATCCATCTGCCAGTGG - Intronic
1018624305 6:165763022-165763044 CCAAGACATGTATTAGTCTGTGG - Intronic
1019086048 6:169478143-169478165 CCAAGAGATCTCTCTGGGTGGGG + Intronic
1019536791 7:1533563-1533585 CCAAGACTTTTGACTGCCTGTGG + Intronic
1027786581 7:82586840-82586862 CCACGGGATCAATCTGCCTGAGG - Intergenic
1030343063 7:108402564-108402586 TCCAACCATCTATCTGCCTGTGG + Intronic
1032189485 7:129755903-129755925 TCAAGACATTCATCTGCCTGTGG - Exonic
1032259336 7:130322403-130322425 CCAAGAGCTCTGCCTGCCTGGGG - Intronic
1034081255 7:148279652-148279674 CCAAGACATCTATCTGCCTGAGG - Intronic
1036097301 8:5738354-5738376 CCAAGGCAGCGATGTGCCTGAGG - Intergenic
1037384320 8:18321101-18321123 AAAAAACATCAATCTGCCTGAGG + Intergenic
1040802355 8:51357266-51357288 CAAAGACATCCATCTACCTGAGG + Intronic
1041189724 8:55341456-55341478 CTGAGACATGTCTCTGCCTGTGG - Intronic
1041390261 8:57341486-57341508 CCAGGATATCTCTGTGCCTGAGG + Intergenic
1042612750 8:70615898-70615920 ATAAGAAATCAATCTGCCTGAGG - Intronic
1042932109 8:74023632-74023654 CCAAGACATGGAACAGCCTGAGG - Intronic
1043086444 8:75840621-75840643 CCAAGACAGATATCAGCTTGAGG + Intergenic
1043741698 8:83821956-83821978 CCAAAATATCTATGTGCCTGGGG - Intergenic
1046566816 8:115912292-115912314 CCAATAAATCTATATGCCTAAGG + Intergenic
1047996883 8:130345426-130345448 ACAAGACATGCATCTGCCAGTGG - Intronic
1049114637 8:140675469-140675491 CCAACATATATATCAGCCTGTGG - Exonic
1051464162 9:17357353-17357375 TCAAGTGATATATCTGCCTGTGG - Intronic
1056282144 9:85051937-85051959 CAAAGTCATATCTCTGCCTGTGG - Intergenic
1060048533 9:120359851-120359873 CCAAGACAAATATCTCCTTGTGG - Intergenic
1061161221 9:128895543-128895565 CCAGGGCATCTCTGTGCCTGGGG - Intronic
1062427383 9:136512266-136512288 CCATGACATCCAGCAGCCTGTGG - Intronic
1186415904 X:9382751-9382773 CCCAGGCATCTGGCTGCCTGGGG - Intergenic
1189902487 X:45721457-45721479 CCAAGATATGTATCTGCTTTTGG - Intergenic
1190726245 X:53192698-53192720 CCCATCCATCTATCTGCCTCAGG + Exonic