ID: 1034081258

View in Genome Browser
Species Human (GRCh38)
Location 7:148279679-148279701
Sequence ACTAGGACATTGATCGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034081255_1034081258 4 Left 1034081255 7:148279652-148279674 CCTCAGGCAGATAGATGTCTTGG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 50
1034081250_1034081258 27 Left 1034081250 7:148279629-148279651 CCTGTCTTTATCTCCCATCTCCT 0: 1
1: 0
2: 7
3: 39
4: 511
Right 1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 50
1034081254_1034081258 7 Left 1034081254 7:148279649-148279671 CCTCCTCAGGCAGATAGATGTCT 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 50
1034081253_1034081258 13 Left 1034081253 7:148279643-148279665 CCATCTCCTCCTCAGGCAGATAG 0: 1
1: 0
2: 2
3: 25
4: 272
Right 1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 50
1034081252_1034081258 14 Left 1034081252 7:148279642-148279664 CCCATCTCCTCCTCAGGCAGATA 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034081258 Original CRISPR ACTAGGACATTGATCGTTAC TGG Intronic
916399899 1:164436118-164436140 CCTAGGACATTGATTATTAAAGG + Intergenic
916894187 1:169144549-169144571 GCTAGGAGATTGATCCTTCCTGG - Intronic
920746586 1:208634838-208634860 GCTGGGACATTGATCTTTCCTGG + Intergenic
921546265 1:216478446-216478468 AACAGGACATTGACCGCTACTGG + Intergenic
1065406999 10:25379490-25379512 ACTAGGACCTTTATCCATACAGG + Intronic
1095054859 12:37586625-37586647 ATTAAGACAATGATCCTTACAGG - Intergenic
1097767212 12:63539710-63539732 GCTAGGACATTGGTCTTTTCTGG - Intergenic
1097783556 12:63734653-63734675 GCTAGGACATTGGTCTTTTCTGG - Intergenic
1100087688 12:90931374-90931396 ACTTGGACATGGATGTTTACAGG - Intronic
1113338005 13:109395292-109395314 ACAAGGACAGTGATCATTGCTGG + Intergenic
1114895218 14:26981245-26981267 ACTAGGACCTTGCTAATTACAGG - Intergenic
1114896662 14:26999260-26999282 ATTAGCACAATGATCGTGACAGG - Intergenic
1116089324 14:40284803-40284825 AATAGGCCATGGATCGGTACCGG + Intergenic
1116635160 14:47385244-47385266 ACTATGACACTGATCGTTTCTGG + Intronic
1118351858 14:64977836-64977858 ATTAGGACATTGATAGGCACAGG - Intronic
1126434133 15:48618651-48618673 AACAGGACATGGACCGTTACTGG - Intronic
1126855685 15:52837250-52837272 AGTAGGACATTAATCTTTCCTGG + Intergenic
1127092169 15:55478212-55478234 ACTAGGACAATGACTGTTATAGG + Intronic
1135429651 16:22372617-22372639 ACTAGGCCATCAATCCTTACGGG + Intronic
1145375536 17:22344206-22344228 ATTAAGACAATGATCCTTACAGG - Intergenic
1151052517 17:70994661-70994683 CATAGGACATTAATGGTTACAGG + Intergenic
1158845649 18:61439930-61439952 ACTAGCATATTAATTGTTACAGG + Intronic
932093227 2:68825074-68825096 GCTAGGATTTTAATCGTTACTGG - Intronic
1170787574 20:19480816-19480838 CCTGGGACACTGATCCTTACTGG + Intronic
1171527398 20:25825666-25825688 ATTAAGACAATGATCCTTACAGG + Intronic
1171549428 20:26030218-26030240 ATTAAGACAATGATCCTTACAGG - Intergenic
1176015821 20:62931539-62931561 AATAGGACATTTACCCTTACAGG + Intronic
957837134 3:85609515-85609537 ACTAGCACAGTGATAGGTACAGG + Intronic
957903032 3:86521685-86521707 ACTAGGGCTTTGATTGTTAATGG - Intergenic
965189463 3:165509283-165509305 GCTGGGACATTGATCTTTTCTGG + Intergenic
975193760 4:71498197-71498219 ACTACGGCATTCATCATTACGGG - Intronic
984381821 4:179002846-179002868 ACTAGGAGTTGGATCATTACTGG - Intergenic
988699036 5:33654609-33654631 ACTAAGACTTTGATCCCTACAGG - Intronic
990637079 5:57740773-57740795 AGGAGGACATTGATACTTACAGG + Intergenic
998223896 5:140311267-140311289 ACCAGGACATTTATTATTACAGG + Intergenic
1003235799 6:4294479-4294501 CCTAGAACCTGGATCGTTACTGG - Intergenic
1012021379 6:93925350-93925372 ACTACGACATTGTTCTTTAGGGG - Intergenic
1014178136 6:118352234-118352256 ACTAGGAAAATGATTGTTAGTGG - Intergenic
1014296488 6:119624960-119624982 ACGAGGACTTTGATAGATACAGG - Intergenic
1016711417 6:147176890-147176912 CCTGGGAGATTGATTGTTACTGG - Intergenic
1021240698 7:18197107-18197129 ACTGGGACATTGACCATTACTGG + Intronic
1024244938 7:47462254-47462276 GCTGTGACAATGATCGTTACTGG - Intronic
1025298251 7:57794211-57794233 ATTAAGACAATGATCCTTACAGG - Intergenic
1031560913 7:123236877-123236899 AATAGGACATTGTTTGTTATAGG + Intergenic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1042915878 8:73875689-73875711 ACTAGGAAATTGATCATTTGGGG - Intronic
1050622129 9:7465269-7465291 AAGAAGACATTGATCATTACAGG - Intergenic
1051412789 9:16808439-16808461 ACTAGGATATTGATAGATTCAGG - Intronic
1051949827 9:22618056-22618078 ACTAGGACATTTATCTTTAGAGG - Intergenic
1052730313 9:32277654-32277676 ACTGGGACATTGGTCTTTTCTGG - Intergenic
1053548202 9:39046028-39046050 ACTAGGGCCTTTATGGTTACTGG - Intergenic
1062682739 9:137790980-137791002 ACTAGGACGTTGATTCTGACAGG - Intronic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1194023027 X:88717322-88717344 ACTTGGACATTGATCATAAATGG + Intergenic