ID: 1034081990

View in Genome Browser
Species Human (GRCh38)
Location 7:148287703-148287725
Sequence CTGTGTCATGGCATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2318
Summary {0: 1, 1: 3, 2: 96, 3: 614, 4: 1604}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034081985_1034081990 1 Left 1034081985 7:148287679-148287701 CCACTTCTGGTGAGGACTTTCTT 0: 1
1: 4
2: 16
3: 143
4: 410
Right 1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG 0: 1
1: 3
2: 96
3: 614
4: 1604
1034081984_1034081990 8 Left 1034081984 7:148287672-148287694 CCAGGGGCCACTTCTGGTGAGGA 0: 1
1: 1
2: 3
3: 29
4: 224
Right 1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG 0: 1
1: 3
2: 96
3: 614
4: 1604
1034081981_1034081990 15 Left 1034081981 7:148287665-148287687 CCAAGGTCCAGGGGCCACTTCTG 0: 1
1: 1
2: 37
3: 154
4: 461
Right 1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG 0: 1
1: 3
2: 96
3: 614
4: 1604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034081990 Original CRISPR CTGTGTCATGGCATGGTGGA GGG Intronic
Too many off-targets to display for this crispr