ID: 1034082960

View in Genome Browser
Species Human (GRCh38)
Location 7:148297544-148297566
Sequence GGGTGCTAGAAAGTGCTATT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034082955_1034082960 13 Left 1034082955 7:148297508-148297530 CCATAGAGGCATCTCAGTAAGAG 0: 1
1: 0
2: 1
3: 8
4: 109
Right 1034082960 7:148297544-148297566 GGGTGCTAGAAAGTGCTATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034082960 Original CRISPR GGGTGCTAGAAAGTGCTATT CGG Intronic
No off target data available for this crispr